View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16196_high_17 (Length: 235)
Name: NF16196_high_17
Description: NF16196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16196_high_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 8594754 - 8594552
Alignment:
| Q |
16 |
aaaatagtgatgtgttcaaattccactacaatatagtgctacagaatccccttttaagaattacatggtattattgtattgccttattcaaggttttatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8594754 |
aaaatagtgatgtgttcaaattccactacaatatagcgctacagaatacccttttaagaattacatggtattattgtattgccttattcaaggttttatt |
8594655 |
T |
 |
| Q |
116 |
caataactcttacttgcaaatgctaatcatgtttttaatccttgatgcttcactatgtaaattccatatataatccttgatttaaagtaattgagaggaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8594654 |
caataactcttacttgcaaatgctaatcatgtttttaatccttgatgcttcactatgtaaattccatatataatccttgatttaaagtaattgagaggaa |
8594555 |
T |
 |
| Q |
216 |
aat |
218 |
Q |
| |
|
||| |
|
|
| T |
8594554 |
aat |
8594552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 83 - 145
Target Start/End: Complemental strand, 19868807 - 19868746
Alignment:
| Q |
83 |
gtattattgtattgccttattcaaggttttattcaataactcttacttgcaaatgctaatcat |
145 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||| ||| |||||| |||||||||||||| |
|
|
| T |
19868807 |
gtattattgtattgccttattcaagg-ttggctcaattacttttacttccaaatgctaatcat |
19868746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 45
Target Start/End: Complemental strand, 3015672 - 3015643
Alignment:
| Q |
16 |
aaaatagtgatgtgttcaaattccactaca |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3015672 |
aaaatagtgatgtgttcaaattccactaca |
3015643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University