View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16196_high_22 (Length: 213)
Name: NF16196_high_22
Description: NF16196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16196_high_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 206
Target Start/End: Original strand, 32403318 - 32403507
Alignment:
| Q |
17 |
attttcaggaagtccacgtgtggcaagcatagtcatgtcttctgctgcaagaaatttaactcctgttactctagagctaggtggaaaatgccctgctata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32403318 |
attttcaggaagtccacgtgtggcaagcatagtcatgtcttctgctgcaagaaatttaactcctgttactctagagctaggtggaaaatgccctgctata |
32403417 |
T |
|
| Q |
117 |
tttgattatccttcagactttaaggtaattcacataacggttcgtgaccgcaaattgtggtcacatgtcaagatttttgttgtctctgct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32403418 |
tttgattatccttcagactttaaggtaattcacataacggttcgtgaccgcaaattgtggtcacatgtcaagatttttgttgtctctgct |
32403507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 24 - 126
Target Start/End: Complemental strand, 6664730 - 6664628
Alignment:
| Q |
24 |
ggaagtccacgtgtggcaagcatagtcatgtcttctgctgcaagaaatttaactcctgttactctagagctaggtggaaaatgccctgctatatttgatt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6664730 |
ggaagtccacgtgtggcaagcatagtcatgtcttctgctgcaagatatttaactcctgttactctagagctaggtggaaaatgccctgctatatttgatt |
6664631 |
T |
|
| Q |
124 |
atc |
126 |
Q |
| |
|
||| |
|
|
| T |
6664630 |
atc |
6664628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 25 - 126
Target Start/End: Complemental strand, 43304928 - 43304827
Alignment:
| Q |
25 |
gaagtccacgtgtggcaagcatagtcatgtcttctgctgcaagaaatttaactcctgttactctagagctaggtggaaaatgccctgctatatttgatta |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43304928 |
gaagtccacgtgtggcaagcatagtcatgtcttttgctgcaagatatttaactcctgttactcgagagctaggtggaaaatgccctgctatatttgatta |
43304829 |
T |
|
| Q |
125 |
tc |
126 |
Q |
| |
|
|| |
|
|
| T |
43304828 |
tc |
43304827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University