View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16196_high_7 (Length: 329)
Name: NF16196_high_7
Description: NF16196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16196_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 281 - 326
Target Start/End: Original strand, 29935308 - 29935353
Alignment:
| Q |
281 |
aactttgagatattgtttgaaagaatttatgaaaacagccagtgat |
326 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29935308 |
aactttaagatattgtttgaaagaatttatgaaaacagtcagtgat |
29935353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University