View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16196_low_13 (Length: 315)
Name: NF16196_low_13
Description: NF16196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16196_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 307
Target Start/End: Original strand, 8594733 - 8595039
Alignment:
| Q |
1 |
aatttgaacacatcactattttatgcgatttgcgattgacaacactattgataagcaagctcatgcgcgcgaaaattgttttacatattgcatttcaact |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8594733 |
aatttgaacacatcactattttatgtgatttgcgattgacaacactattgataagcaagcgcatgcgcgcgaaaattgttttacatattgcatttcaacc |
8594832 |
T |
|
| Q |
101 |
tcacaaaaaccttatgaaatttatctacggaatatttatgaaccatcacggcgtcattgctataatcttttctgttagtttgcatcctttgttcacgaat |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8594833 |
tcacaaaaaccttatgaaatttatttacggaatatttatgaaccatcacggcgtcattgctataatcttttctgttaatttgcatcctttgttcacgaat |
8594932 |
T |
|
| Q |
201 |
gtagattttttcatggaacatagcaagcttgtcactcgacagnnnnnnnnnnnncttctaatagctcctctctctctgaccctaccctcgtcccatgtca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8594933 |
gtagattttttcatggaacatagcaagcttgtcactcgacagttttttatttttcttctaatagctcctctctctctgaccctaccctagtcccatgtcg |
8595032 |
T |
|
| Q |
301 |
ttcttct |
307 |
Q |
| |
|
||||||| |
|
|
| T |
8595033 |
ttcttct |
8595039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 27010057 - 27010110
Alignment:
| Q |
1 |
aatttgaacacatcactattttatgcgatttgcgattgacaacactattgataa |
54 |
Q |
| |
|
|||||||||| |||||||||| |||| ||||| ||||||||||||||||||||| |
|
|
| T |
27010057 |
aatttgaacaaatcactatttaatgcaatttgtgattgacaacactattgataa |
27010110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University