View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16197_high_3 (Length: 244)
Name: NF16197_high_3
Description: NF16197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16197_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 36061300 - 36061524
Alignment:
| Q |
1 |
atttgtggattgatttctttattatttctctgacgaagtatagaaacgaaaattatagaaaatggattcaatgagtttcgcaatataaaatttgggttgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36061300 |
atttgtggattgatttctttattatttctctgacgaagtatagaaacgaaa-ttatagaaaatggactcaatgagtttcgcaatataaaatttgggttgc |
36061398 |
T |
 |
| Q |
101 |
tcgtcatatgataataaacaaacacaaaataagttcattgcttcacgctattagaaaccttagaaagattggtttgttttctagttattgataattttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36061399 |
tcgtcatatgataataaacaaacacaaaataagttcattgcttcacgctattagaaaccttagaaagattggtttgttttctagttattgataattttga |
36061498 |
T |
 |
| Q |
201 |
tgaaccatattagccaataggcttgc |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
36061499 |
tgaaccatattagccaataggcttgc |
36061524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 32198114 - 32198071
Alignment:
| Q |
5 |
gtggattgatttctttattatttctctgacgaagtatagaaacga |
49 |
Q |
| |
|
|||||||||||||||||||| |||| ||| ||||||||||||||| |
|
|
| T |
32198114 |
gtggattgatttctttatta-ttctatgatgaagtatagaaacga |
32198071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University