View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16197_high_7 (Length: 221)

Name: NF16197_high_7
Description: NF16197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16197_high_7
NF16197_high_7
[»] chr1 (1 HSPs)
chr1 (11-204)||(15976322-15976513)


Alignment Details
Target: chr1 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 11 - 204
Target Start/End: Complemental strand, 15976513 - 15976322
Alignment:
11 gagtagcatagggatgtaatttttggatgacaccaacatttttatcatagactgttttgtgactctttgagtagaattagtagtgtaatttcaatgatga 110  Q
    |||| ||||| |||||||||||||||||||||   |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
15976513 gagtggcatatggatgtaatttttggatgaca---acatttttatcatagactgttttgtgactctttgagcagaattagtagtgtaatttcaatgatga 15976417  T
111 tgagtgattttagaggtataaaatatcattttattttctcagttgttactccgttgtgattga-ttgatttattataaaatcttgaataccttgt 204  Q
    |||||| |||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| || |||| |||||||||||||||||||||||    
15976416 tgagtggttttagaggtatgaaatatcattttattgtctcagttgttactccgttgtgattgattttattttttataaaatcttgaataccttgt 15976322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University