View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16197_low_7 (Length: 237)
Name: NF16197_low_7
Description: NF16197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16197_low_7 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 18 - 237
Target Start/End: Complemental strand, 13000388 - 13000173
Alignment:
| Q |
18 |
attagatgctttgaacttttttgttcaagatcataaagtaatgaaaggattcaagatttatcttgccaacccaaactcaccaatatcactatcatattgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13000388 |
attagatgctttgaacttttttgttcaagatcataaagtaatgaaaggattcaagatttatcttgctaacccaaactcaccaatatcactatcatattgt |
13000289 |
T |
|
| Q |
118 |
cttatatatcatggttgttannnnnnnnnnnnnnnnngtaataaaattttggaaggtgatactcatcacattttttgttactaataattaattaaatatg |
217 |
Q |
| |
|
|| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13000288 |
ct----tatcatggttgttattttcttttgcttttttgtaataaaattttggaaggtgatactcatcacattttttattactaataattaattaaatatg |
13000193 |
T |
|
| Q |
218 |
ttgaggagttagtaacattt |
237 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
13000192 |
ttgaggagttagtaacattt |
13000173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 199
Target Start/End: Complemental strand, 13000166 - 13000122
Alignment:
| Q |
155 |
gtaataaaattttggaaggtgatactcatcacattttttgttact |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13000166 |
gtaataaaattttggaaggtgatactcatcacattttttgatact |
13000122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University