View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16198_low_3 (Length: 219)
Name: NF16198_low_3
Description: NF16198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16198_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 17 - 202
Target Start/End: Complemental strand, 302271 - 302085
Alignment:
| Q |
17 |
aatatatacccggaacacaagaaagacactgcccttggaatcaatcaaaattttataaaggatgcaactatttcaaaaagaaaatttgtaaaaagacat- |
115 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
302271 |
aatatatacccggaacacaagaaagatactgcc-ttggaatcaataaattttttataaaggatgcaactatttcaaaaagaaaatttgtaaaaagacata |
302173 |
T |
|
| Q |
116 |
-taaaatttgaacaaggatttgcttaagctggaagatcagtctattgtaaaatgacaaatatgcacaccagaatatggatacaatatt |
202 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
302172 |
ttaaaatttgaacaaggatttgctgaagctggaagatcagtctattgtaaaatgacaaatattcacaccagaatatggatacaatatt |
302085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University