View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16199_high_6 (Length: 308)
Name: NF16199_high_6
Description: NF16199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16199_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 9 - 307
Target Start/End: Original strand, 22155007 - 22155305
Alignment:
| Q |
9 |
agcagagataatcagaagcgacgagagggtcttgatgaagaagtagtccaggatccacgatcaacacgtctggctagcatcagacaacaccctgatgaaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22155007 |
agcagagataatcagaagcgacgagagggtcttgatgaagaagtagtccaggatccacgatcaacacgtctggctagcatcagacaacaccctgatgaaa |
22155106 |
T |
 |
| Q |
109 |
atgagcagggattctatagaaaagagcatgatggaaagcaagatcccgaaagaaatcacatggtacttagaggtagagatggatcatacccttacaagga |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22155107 |
atgagcagggattctatagaaaagagcatgatggaaagcaagatcccgaaagaaatcacatggtacttagaggtagagagggatcatacccttacaagga |
22155206 |
T |
 |
| Q |
209 |
ccggcatcgtagcttggcccatcaattgcatacaaatactgacggatttgataggcaaaaagatagggacagttctgacatggattgggcaaggagaga |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22155207 |
ccggcatcgtagcttggcccatcaattgcatacaaatactgacggatttgataggcaaaaagatagggacagttctgacatggattgggcaaggagaga |
22155305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University