View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1619_high_45 (Length: 242)
Name: NF1619_high_45
Description: NF1619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1619_high_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 18840676 - 18840457
Alignment:
| Q |
1 |
attcttcagcttaagctgaggaagctttgcatgaatggagaacttgtttgtactaagaacggaagatatgtgcttgttgatgcagtggagaaggatgcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
18840676 |
attcttcagcttaagctgaggaagctttgcatgaatggagaacttgtttgtactaagaacggaagatatgtgcttgttgatgccgtggagaaggatgcaa |
18840577 |
T |
 |
| Q |
101 |
ttcatccgaaaaataatatttcttctgaagttttaccgaaaaggatagtagaccggaagactaagaatctgagaggaaaggaaatttgtaccgtaaaagt |
200 |
Q |
| |
|
|||||| |||||||||| |||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18840576 |
ttcatcagaaaaataatttttcttttgaagttttaccaaaaaggatagtagaccggaagactaagaatctgagaggaaaggaaattggtaccgtaaaagt |
18840477 |
T |
 |
| Q |
201 |
catttggggaagaccgtcgt |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
18840476 |
catttggggaagaccgtcgt |
18840457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University