View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1619_high_46 (Length: 242)
Name: NF1619_high_46
Description: NF1619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1619_high_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 41 - 227
Target Start/End: Complemental strand, 33193966 - 33193783
Alignment:
| Q |
41 |
ccttgttatttacatacaaatatgacagaaacaacacaagtagtagtactcagatcaaacaggctttggtcagaaagaaagaatcataggtgaggactgc |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33193966 |
ccttgttatttacatacaaatatgacagaaacaacacaagtagtagtactcagatcaaacatgctttggtcagaaagaaagaatcataggtgaggactgc |
33193867 |
T |
 |
| Q |
141 |
aacagaatatgatgcttaaatatggttagagagtgctttcataacacccac-------tagacactagaaagcatatatgaattctgaaaactc |
227 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33193866 |
aacagaatatgatgc----------ttagagagtgctttcataacacccactagacagtagacactagaaagcatatatgaattctgaaaactc |
33193783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 5 - 47
Target Start/End: Complemental strand, 45691395 - 45691353
Alignment:
| Q |
5 |
tttttgaggtctgatttaagttcctgattaatcaaaccttgtt |
47 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
45691395 |
tttttgaggtctgatttaacttcctgattaatcaaagcttgtt |
45691353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University