View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1619_high_51 (Length: 237)
Name: NF1619_high_51
Description: NF1619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1619_high_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 33194018 - 33194255
Alignment:
| Q |
1 |
tattctcccttagtttttgggggttcttaaagcttgtgactacgttgcaggacttccactcacttgtttcacattgctttgttaagcttggtttagcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33194018 |
tattctcccttagtttttgggggttcttaaagcttgtgactacgttgcaggacttccactcacttgtttcacattgctttgttaagcttggtttagcatt |
33194117 |
T |
 |
| Q |
101 |
tc------------ttaattggtatgttttctccatctcttgcattt-----tagtttctatcttttctcaagttttatgtggttggatctatacgtgtt |
183 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33194118 |
tccctctacatttcttaattggtatgttttctccatctcttgcattttattttagtttctatcttttctcaagttttatgtggttggatctatacgtgtt |
33194217 |
T |
 |
| Q |
184 |
gctctttgcatcaggatcttagtatataacttctcatt |
221 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33194218 |
gctctttgcatcaggatcttagtacataacttctcatt |
33194255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University