View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1619_high_57 (Length: 208)
Name: NF1619_high_57
Description: NF1619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1619_high_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 8 - 186
Target Start/End: Original strand, 53130046 - 53130228
Alignment:
| Q |
8 |
tcgaagaatataaaaaagttcaaaaaccctccaaaatagagtgtctgaaaaacttggagggtgggaaaagaaactctttaagagtgggcctta----agg |
103 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
53130046 |
tcgaaaaatgtaaaaaagttcaaaaaccctccaaaatagagtgtctgaaaaacttggagggtgggaaaagaaactctttaagagtgcgccttatttaagg |
53130145 |
T |
|
| Q |
104 |
cccagcccaattatctgcgtgcgaattacccaaaacgcagagttttggtattcaaaaccccagagtcccgaaaacaagagaga |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53130146 |
cccagcccaattatctgcgtgcgaattacccaaaacgcagagttttggtattcaaaaccccagagtcccgaaaacgagagaga |
53130228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University