View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1619_low_24 (Length: 332)
Name: NF1619_low_24
Description: NF1619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1619_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 204
Target Start/End: Complemental strand, 31638445 - 31638260
Alignment:
| Q |
19 |
agtatagttttggaattaataggtttttctctaaactcagcacaagatatgcaggaaaagaaaaagaagcattttctttcttgttcaacagcgatgtatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31638445 |
agtatagttttggaattaataggtttttctctaaactcagcacaagatatgcaggaaaagaaaaagaagcattttctttcttgttcaacagcgatgtatc |
31638346 |
T |
 |
| Q |
119 |
tgcttcaacgtgaatcaatggtgctactaaagacaggtaattcttcatatagtttttcttgtattttcactggatcttagttacta |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31638345 |
tgcttcaacgtgaatcaatggtgctactaaagacaggtaattcttcatatagtttttcttgtattttcactggatcttagttacta |
31638260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 285 - 322
Target Start/End: Complemental strand, 31638193 - 31638156
Alignment:
| Q |
285 |
atcatcacttgtctttttaagatgcggataatattcat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31638193 |
atcatcacttgtctttttaagatgcggataatattcat |
31638156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 104 - 204
Target Start/End: Original strand, 31671429 - 31671532
Alignment:
| Q |
104 |
caacagcgatgtatctgcttcaacgtgaatcaatggtgctactaaagac--aggtaattcttcata-tagtttttcttgtattttcactggatcttagtt |
200 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| ||| ||||||| || ||||||||| | | | |||||||| || | |||| |||||||||||||| |
|
|
| T |
31671429 |
caacagcgatgtctctccttcaacgtgaatcaaaggtaatactaaatacataggtaattcattacattagtttttgttatgttttgactggatcttagtt |
31671528 |
T |
 |
| Q |
201 |
acta |
204 |
Q |
| |
|
|||| |
|
|
| T |
31671529 |
acta |
31671532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University