View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1619_low_30 (Length: 283)
Name: NF1619_low_30
Description: NF1619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1619_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 7553707 - 7553435
Alignment:
| Q |
1 |
attattttaggaaaagtaagttctacattttagcagccctcatatgataatactcaagaaattagcacctcatttttatagctgacaggcttttgaaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7553707 |
attattttaggaaaagtaagttctacattttagcagccctcatatgataatactcaagaaattagcacctcatttttatagctaacaggcttttgaaata |
7553608 |
T |
 |
| Q |
101 |
aaaggagtccacatgactacatgctttcaaaatctctaactacagttctgccagtttcttctgtgcatcttttgcaacattttaaaggccaaaaatattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7553607 |
aaaggagtccacatgactacatgctttcaaaatctctaactacagttctgccagtttcttctgtgcatcttttgcaacattttaaaggccaaaattattc |
7553508 |
T |
 |
| Q |
201 |
caccatattggcatacatgctacattaacttgtataaaaactactaatatactttaaaattcttttacctttg |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7553507 |
caccatattggcatacatgctacattaacttgtataaaaactactaatatactttaaaactcttttacctttg |
7553435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University