View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1619_low_39 (Length: 255)
Name: NF1619_low_39
Description: NF1619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1619_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 109 - 240
Target Start/End: Original strand, 34518240 - 34518371
Alignment:
| Q |
109 |
cactttattaatagggaatcttggtctctaagcttccgcagccgtcttgtctacgcgccgtcgtttcttgcgctgccgcagttctcacacaaggtatgtt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34518240 |
cactttattaatagggaatcttggtctctaagcttccgcagccgtcttgtctacgcgccgtcgtttcttgcgctgccgcagttctcacacaaggtatgtt |
34518339 |
T |
 |
| Q |
209 |
ttatgtcattgcattctagattaaatatatat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34518340 |
ttatgtcattgcattctagattaaatatatat |
34518371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 12 - 63
Target Start/End: Original strand, 34518142 - 34518193
Alignment:
| Q |
12 |
atatatatctgaaaatactcctaaaaaaatatacgtgtgaaagttttgtatt |
63 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34518142 |
atatatatttgaaaatactcctaaaaaaatatacgtgtgaaagttttgtatt |
34518193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University