View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1619_low_45 (Length: 246)
Name: NF1619_low_45
Description: NF1619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1619_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 16513554 - 16513783
Alignment:
| Q |
1 |
tatgcaaatatccttgacttactaatgcagttgagacggtgttgtaaccatccgtttttggtcatgaggttggtgtggcaaacacattaaactgttcttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| ||||| |||||||||||||||| ||||| |
|
|
| T |
16513554 |
tatgcaaatatccttgacttactaatgcagttgagacggtgctgcaaccatccgtttttggtcatgaggtcggtgtagcaaacacattaaactattcttt |
16513653 |
T |
 |
| Q |
101 |
ccattcctaattcttctaccagtaataattaggtttgcaat-tttgcagtggaagtgatactgccaagtatgcagacttgagcagacttgcaagaaaatt |
199 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16513654 |
ccattcctaattcttctaccaataataattaattttgcaatgtttgcagtggaagtgatactgccaagtatgcagacttgagcagacttgcaagaaaatt |
16513753 |
T |
 |
| Q |
200 |
cctcgagtctcatactgaatcatctgatat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16513754 |
cctcgagtctcatactgaatcatctgatat |
16513783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University