View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1619_low_49 (Length: 239)
Name: NF1619_low_49
Description: NF1619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1619_low_49 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 239
Target Start/End: Original strand, 28270 - 28496
Alignment:
| Q |
13 |
aatatgtgttaaaaattgttatgtttccaatataattaatcattttctctgtaaaatatatatattggatacttttatttacttaaccaatggccatttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28270 |
aatatgtgttaaaaattgttatgtttccaatataattaatcattttctctgtaaaatatatatattggatacttttatttacttaaccaatggccatttt |
28369 |
T |
 |
| Q |
113 |
tgttgaaaatatatgatttgtctttcttttcctactctgttgtgtgtttttcactcatcatgaaataaaatactaaatccaaatgannnnnnnagttgta |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28370 |
tgttgaaaatatatcatttgtctttcttttcctactctgttgtgtgtctttcactcatcatgaaataaaatactaaatccaaatgatttttttagttgta |
28469 |
T |
 |
| Q |
213 |
tacgaaatgaatgtgaatagatgatga |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
28470 |
tacgaaatgaatgtgaatagatgatga |
28496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University