View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16200_low_5 (Length: 230)
Name: NF16200_low_5
Description: NF16200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16200_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 49 - 187
Target Start/End: Original strand, 52583260 - 52583398
Alignment:
| Q |
49 |
catttatttgggacattatggcatctcttaagctacaaaaatgcctagacattgcttgaagtgccagagcagtgtaacactttgcagctcccaaacctgc |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52583260 |
catttatttgggacattatggcatctcttaagctacaaaaatgcctagacattgcttgaagtgccagagcagtgtaacactttgcagctcccaaacctgc |
52583359 |
T |
|
| Q |
149 |
tatcatttcaaaagatgatactacttcttccatttgatg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52583360 |
tatcatttcaaaagatgatactacttcttccatttgatg |
52583398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University