View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16202_low_5 (Length: 241)
Name: NF16202_low_5
Description: NF16202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16202_low_5 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 3e-50; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 137 - 241
Target Start/End: Original strand, 11151303 - 11151407
Alignment:
| Q |
137 |
atgtcttcattactgcacataaaattaatgtcaaatgaaaaaacatagaagaaaccctgtttcattacctggataacaattaaccaaactgtagaatata |
236 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11151303 |
atgtcttcattactgaacataaaattaatgtcaaatgaaaaaacatagaagaaaccctgtttcattacctggataacaattaaccaaactgtagaatata |
11151402 |
T |
|
| Q |
237 |
tgctt |
241 |
Q |
| |
|
||||| |
|
|
| T |
11151403 |
tgctt |
11151407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 18 - 75
Target Start/End: Original strand, 11151248 - 11151305
Alignment:
| Q |
18 |
cataggaagtgagaaattaaaattaaactactaatattgatttgtggaattcttcatg |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11151248 |
cataggaagtgagaaattaaaattaaactactaatattgatttgtggaattcttcatg |
11151305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 30 - 109
Target Start/End: Complemental strand, 11173028 - 11172945
Alignment:
| Q |
30 |
gaaattaaaattaaacta--ctaata--ttgatttgtggaattcttcatgattgttatatgttacaactaacttcttcatatcc |
109 |
Q |
| |
|
|||||| ||||||||||| |||||| ||| |||||| ||| ||||||||||||||||||| | ||||||||||||| |||| |
|
|
| T |
11173028 |
gaaattgaaattaaactatactaataaattggtttgtgagattgttcatgattgttatatgtttccactaacttcttcagatcc |
11172945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University