View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16202_low_7 (Length: 235)
Name: NF16202_low_7
Description: NF16202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16202_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 10 - 215
Target Start/End: Original strand, 5957666 - 5957871
Alignment:
| Q |
10 |
ggagcagcacagagggagtttctacctacggtgcgtgtgcacgagtttccaatggacccagatatatacaccgaatggaagatgttacaatggaagccgc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5957666 |
ggagcagcacagagggagtttctacctacggtgcgtgtgcaggagtttccaatggacccagatatatacacagaatggaagatgttacaatggaagccgc |
5957765 |
T |
|
| Q |
110 |
cggagtttgcgcgagcacctggtgggccaccgtcgaatgtggcggtggcccatgtcaggcttggcggacgggcggctttgttggggaaagttggggagga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5957766 |
cggagtttgcgcgagcacctggtgggccgccgtcgaatgtggcggtggcccatgtcaggcttggcggacgggcggctttgttggggaaagttggggagga |
5957865 |
T |
|
| Q |
210 |
tgagtt |
215 |
Q |
| |
|
|||||| |
|
|
| T |
5957866 |
tgagtt |
5957871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University