View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16203_low_8 (Length: 286)
Name: NF16203_low_8
Description: NF16203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16203_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 35 - 266
Target Start/End: Original strand, 34532678 - 34532909
Alignment:
| Q |
35 |
ataagcataattaacgtctgcaaaaacttatnnnnnnntactaataaacagtgataaaagaactcaattcaaattaccttggtggcataaccgctatcaa |
134 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34532678 |
ataagcataattaacgtctgcgaaaacttataaaaaaatactaataaacagtgataaaagaactcaattcaaattaccttggtggcataaccgctatcaa |
34532777 |
T |
|
| Q |
135 |
gcaaccaatctacaggtatttggaagactttgaatctctttgttgctgactctctcattctagaaatgttgtaaaccccatgttctaatctgttgcaaca |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34532778 |
gcaaccaatctacaggtatttggaagactttgaatctctttgttgctgactctctcattctagaaatgttgtaaaccccatgttctaatctgttggaaca |
34532877 |
T |
|
| Q |
235 |
tttaaaaacaaaagtgtcaagtagttttctat |
266 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |
|
|
| T |
34532878 |
tttaaaaacaaaagtgttaagtagttttctat |
34532909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University