View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16204_low_1 (Length: 413)
Name: NF16204_low_1
Description: NF16204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16204_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 19 - 381
Target Start/End: Complemental strand, 28022982 - 28022620
Alignment:
| Q |
19 |
atttcaacattgagacgatgaagggtgaaagtatcaaggggaatgccccaatatcgtgaaactttgtcgcacaggtcactcaccttatcggtctccttca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28022982 |
atttcaacattgagacgatgaagggtgaaagtatcaaggggaatgccccaataccgtgaaactttgttgcacaggtcactcaccttatcggtctccttca |
28022883 |
T |
 |
| Q |
119 |
ccctcacatagccattgctgccatggccaagaaacttcactaaaacatgtagtttcaggtctgatggcagtggatcaacaatgagagtaactgtttctgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28022882 |
ccctcacatagccattgctgccatggccaagaaacttcactaaaacatgtagtttcaggtctgatggcagcggatcaacaatgagagtaactgtttctgt |
28022783 |
T |
 |
| Q |
219 |
ttcatctccgcacaaagcatagaatccaatccttttctcattatccaactctatacccttgtaccagagattttgcctgtgtactcccacctccaactcg |
318 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28022782 |
ttcatctccgcgcaaagcatagaatccaatccttttctcattatccaactctatacccttgtaccagagattttgcctgtgtactcccacctccaactcg |
28022683 |
T |
 |
| Q |
319 |
tcttcgattttgcttttaagatcaaaaacaagttctgataccgatatttctaccacaggttct |
381 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28022682 |
ttttcgattttgcttttaagatcaaaaacaagttctgataccgatatttctaccacaggttct |
28022620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University