View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16205_low_7 (Length: 265)

Name: NF16205_low_7
Description: NF16205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16205_low_7
NF16205_low_7
[»] chr6 (1 HSPs)
chr6 (1-250)||(7558342-7558591)


Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 7558342 - 7558591
Alignment:
1 agaggaaaattcaactatattactcttaattgtttcaaaataatcaaaatattaaatctataattttgtgaccatagaagtctactatcttaatcttatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7558342 agaggaaaattcaactatattactcttaattgtttcaaaataatcaaaatattaaatctataattttgtgaccatagaagtctactatcttaatcttatc 7558441  T
101 gtattttattgagtatgaaataatgtagtatgacatcctagaaactatgactctgtcaataattaatatgcattctagaaagtcatatggctcaatatac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||    
7558442 gtattttattgagtatgaaataatgtagtatgacatcctagaaactatgaccctgtcaataattaatatgcattctagaaagtcatatgactcaatatac 7558541  T
201 tattgtcattaacgtgttacacatgaaaacgaccatggcccataatttct 250  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
7558542 tattgtcattaacgtgttacacatgaaaacgaccatggcccataatttct 7558591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University