View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16206_high_2 (Length: 275)
Name: NF16206_high_2
Description: NF16206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16206_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 6741986 - 6742255
Alignment:
| Q |
1 |
ttatactgtaaccacagcatggtaggagcctgctgcaatctc--ccaccccattcacttgtgtaagttaaaaagttctttgg--agatgttgaaacaaac |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
6741986 |
ttatactgtaaccacagcatggtaggagccagctgcaatctctcccaccccattcacttgtgtaagttaaaaagttctttggttagaggttgaaacaaac |
6742085 |
T |
 |
| Q |
97 |
agaacttttacagttattttttgggatctatcaaacatgaacaaatgactctagtctttcacaatgcacataatttatctatcattaattaattgagtaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6742086 |
agaacttttacagttattttttgggatctatcaaacatgaacaaatgactctagtctttcacaatgcacataatttatctatcattaattaattgagtaa |
6742185 |
T |
 |
| Q |
197 |
ttttattgcatctaatattgaactattcacactatatttccttgcttcgttccaatatcttgctctgtgc |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
6742186 |
ttttattgcatctaatattgaactattcacactatatttccttgcttcgttccaataacttgctttgtgc |
6742255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University