View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16207_high_6 (Length: 229)
Name: NF16207_high_6
Description: NF16207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16207_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 49268531 - 49268738
Alignment:
| Q |
1 |
gagttttagtttcggccatgaacataaaattccataattaaacatgtttgatttggaccaattatgggatgaatggtctatgagaagtttttcttataat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49268531 |
gagttttagtttcggccatgaacataaaattcaataattaaacatgtttgatttggaccaattatgggatgaatggtctacgagaagtttttcttataat |
49268630 |
T |
 |
| Q |
101 |
gtgtaacgggaaaacacattgaaaaaatatattggtaccatagcgcacatcgtctcctagtaagatgtggtgcatgaaggaaccaaatgaggagtagtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49268631 |
gtgtaacgggaaaacacattgaaaaaatatattggtaccatagcgcacatcgtctcctagtaagatgtcgtgcatgaaggaaccaaatgaggagtagtga |
49268730 |
T |
 |
| Q |
201 |
gcatgtag |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
49268731 |
gcatgtag |
49268738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University