View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16208_high_8 (Length: 257)
Name: NF16208_high_8
Description: NF16208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16208_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 15 - 238
Target Start/End: Complemental strand, 44805875 - 44805652
Alignment:
| Q |
15 |
cacagatgccagaagaggaaactcgttcgtctgatgatgaaggcaacttcagcacttcttctaccatggttactggtaaactgacccccaagtgcttaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44805875 |
cacagatgccagaagaggaaactcgttcgtctgatgatgaaggcaacttcagcacttcttctaccatggttactggtaaactgacccccaagtgcttaaa |
44805776 |
T |
 |
| Q |
115 |
cactgcctctattcaagtcatttctcctgttaaagccatagagtcgcccaaaaaggaaactagccaaaagaaaaatctcactgcctctagtcaagtcact |
214 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44805775 |
cactgcctctattcaagtcacttctcctgttaaagccatagagtcgcccaaaaaggaaactagccaaaagaaaaatctcactgcctctagtcaagtcact |
44805676 |
T |
 |
| Q |
215 |
tctcctgttaaaaccatagagtca |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
44805675 |
tctcctgttaaaaccatagagtca |
44805652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 115 - 188
Target Start/End: Complemental strand, 44805697 - 44805624
Alignment:
| Q |
115 |
cactgcctctattcaagtcatttctcctgttaaagccatagagtcgcccaaaaaggaaactagccaaaagaaaa |
188 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44805697 |
cactgcctctagtcaagtcacttctcctgttaaaaccatagagtcacccaaaaaggaaactagccaaaagaaaa |
44805624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University