View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16209_low_3 (Length: 309)
Name: NF16209_low_3
Description: NF16209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16209_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 72; Significance: 9e-33; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 224 - 295
Target Start/End: Complemental strand, 17795103 - 17795032
Alignment:
| Q |
224 |
caatttaactttggagttcaatcaaacgagtgtgtacacattacattataaataaagttaatcacaaatatt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17795103 |
caatttaactttggagttcaatcaaacgagtgtgtacacattacattataaataaagttaatcacaaatatt |
17795032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 70 - 100
Target Start/End: Complemental strand, 17795693 - 17795663
Alignment:
| Q |
70 |
aaattaaacctactttagaatcacttatttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
17795693 |
aaattaaacctactttagaatcacttatttt |
17795663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University