View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1620_high_3 (Length: 233)
Name: NF1620_high_3
Description: NF1620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1620_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 5 - 124
Target Start/End: Complemental strand, 32822255 - 32822136
Alignment:
| Q |
5 |
aataagatttagaaaaagtaatattacatacttggtattgatcttaatggaacacatgtgcatcgtccctattttgtgttttgtgttattattgcacaaa |
104 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| | ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32822255 |
aataagatttaaaaaaagtaatattacatacttggtattgatcttcatggaacacatgtgcaccatccctattttgtgttttgtgttattattgcataaa |
32822156 |
T |
|
| Q |
105 |
gagaatcctcgccttcacta |
124 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
32822155 |
cagaatcctcgccttcacta |
32822136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University