View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16211_low_3 (Length: 202)
Name: NF16211_low_3
Description: NF16211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16211_low_3 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 8 - 202
Target Start/End: Complemental strand, 2327068 - 2326874
Alignment:
| Q |
8 |
tgaaaagaaggataaacctcaaaagtagaaacttttttgactgctgtgatcatctgtattaatcttctaacggcatatgttcgtaaacctataaagttgc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2327068 |
tgaaaagaaggataaacctcaaaagtagaaacttttttgactgctgtgatcatctgtattaatcttctaacggcatatgttcgtaaacctataaagttgc |
2326969 |
T |
 |
| Q |
108 |
aacatcatcagttaagaataagttgtttgtgagaacgttaaattgggtaagcttgtcattaacttttgctctattattcttgcagcaaagaaggc |
202 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2326968 |
aacatcatcagttaagaataagttgcttgtgagaacattaaattgggtaagcttgtcattaacttttgctatattattcttgcagcaaagaaggc |
2326874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University