View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16212_low_8 (Length: 203)
Name: NF16212_low_8
Description: NF16212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16212_low_8 |
 |  |
|
| [»] scaffold0350 (1 HSPs) |
 |  |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |  |
|
| [»] scaffold0161 (1 HSPs) |
 |  |  |
|
| [»] scaffold0334 (1 HSPs) |
 |  |  |
|
| [»] scaffold0053 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 8e-60; HSPs: 42)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 15 - 188
Target Start/End: Complemental strand, 41974875 - 41974700
Alignment:
| Q |
15 |
tgaagaaaaggaaatatacattcaaatacctacnnnnnnnnn-gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaa |
113 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41974875 |
tgaagaaaagaaaatatacattcaaatacctacttctttttttgtggtggccggggtttgaacctcaaaccttgcatatattatgcattatccctatcaa |
41974776 |
T |
 |
| Q |
114 |
ctgaactaaact-acgagtactcaaatacctacttcggaaagtgtgcaaaacaagatccaagttggctaaaaaagt |
188 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41974775 |
ctgaactaaactcacgagtactcaaatacctacttctgaaagtgtgcaaaacaagatccaagttggctaaaaaagt |
41974700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 59 - 122
Target Start/End: Complemental strand, 13401666 - 13401603
Alignment:
| Q |
59 |
ggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||| ||||||||| ||| | |||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
13401666 |
ggtggtcggggtttgaaccccgaaccttacatatattatgcattgtctctatcaactgaactaa |
13401603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 16033440 - 16033500
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||| ||||| ||| || ||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
16033440 |
gtggtggccggagtttgaaccccagaccttgcatatattatgcattgtccctatcaactga |
16033500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 57 - 115
Target Start/End: Original strand, 16967184 - 16967242
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaact |
115 |
Q |
| |
|
||||||||||| ||||| ||||| |||||| ||||||||||||||| ||| |||||||| |
|
|
| T |
16967184 |
gtggtggccggagtttgaacctcgaaccttgcatatattatgcattgtccatatcaact |
16967242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 65 - 114
Target Start/End: Original strand, 15670640 - 15670689
Alignment:
| Q |
65 |
cggggtttgtacctcaaaccttacatatattatgcattatccctatcaac |
114 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||| |||||| |||||||| |
|
|
| T |
15670640 |
cggggtttgaaccccaaaccttacatatattatgtattatcactatcaac |
15670689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 27533314 - 27533249
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||| ||||||||| ||| | |||||| ||||||||||||||| |||||| ||||||| |||| |
|
|
| T |
27533314 |
gtggtggtcggggtttgaaccccgaaccttgcatatattatgcattgtccctaccaactgatctaa |
27533249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 43356506 - 43356442
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||| ||||||||| || |||||||||||||||||||||||| | |||| |||||||||||| |
|
|
| T |
43356506 |
gtggtggtcggggtttgaactccaaaccttacatatattatgcattgt-cctaccaactgaactaa |
43356442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 106
Target Start/End: Complemental strand, 45677356 - 45677307
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatcc |
106 |
Q |
| |
|
||||||||||||||||| || |||||||||||||| ||||||||||||| |
|
|
| T |
45677356 |
gtggtggccggggtttgaactccaaaccttacatatgttatgcattatcc |
45677307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 114
Target Start/End: Original strand, 49431983 - 49432040
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaac |
114 |
Q |
| |
|
||||||||||||||||| ||| | ||||||||||||||||||||||| |||| |||| |
|
|
| T |
49431983 |
gtggtggccggggtttgaaccccggaccttacatatattatgcattattcctaccaac |
49432040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 17669716 - 17669656
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||| ||||| ||| | |||||| |||||||||| |||| |||||||||||||| |
|
|
| T |
17669716 |
gtggtggccggagtttgaaccccgaaccttgcatatattatacattgtccctatcaactga |
17669656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 17917128 - 17917196
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||||| ||||||||| | | | |||||||||||| ||||||||| ||| |||||||||| ||||||| |
|
|
| T |
17917128 |
gtggtggtcggggtttgaatcccgaaccttacatattttatgcattgtccatatcaactgagctaaact |
17917196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 109
Target Start/End: Original strand, 33020033 - 33020085
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatcccta |
109 |
Q |
| |
|
|||||||| |||||||| |||||| ||||| ||||||||||||||| |||||| |
|
|
| T |
33020033 |
gtggtggctggggtttgaacctcagaccttgcatatattatgcattgtcccta |
33020085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 65 - 117
Target Start/End: Original strand, 33153878 - 33153930
Alignment:
| Q |
65 |
cggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
33153878 |
cggggtttgaacctcggaccttacatatattatgcattgtccctaccaactga |
33153930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 82 - 122
Target Start/End: Complemental strand, 34485923 - 34485883
Alignment:
| Q |
82 |
accttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
34485923 |
accttacatatattatgcattatccccatcaactgagctaa |
34485883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 70 - 118
Target Start/End: Complemental strand, 35632957 - 35632909
Alignment:
| Q |
70 |
tttgtacctcaaaccttacatatattatgcattatccctatcaactgaa |
118 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
35632957 |
tttgaacctcaaaccttatatatattatgcattgtccatatcaactgaa |
35632909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 66 - 117
Target Start/End: Complemental strand, 10841962 - 10841911
Alignment:
| Q |
66 |
ggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||||| | ||||||||||| |||||||||||||| ||| |||||||||| |
|
|
| T |
10841962 |
ggggtttgaatctcaaaccttatatatattatgcattgtccatatcaactga |
10841911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 78 - 117
Target Start/End: Original strand, 19396202 - 19396241
Alignment:
| Q |
78 |
tcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
19396202 |
tcaaaccttgcatatattatgcattatccctaccaactga |
19396241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 3481632 - 3481566
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgca-ttatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||||||||| ||| || ||||| ||||||||||||| || |||||| ||||||| |||| |
|
|
| T |
3481632 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcatttgtccctaccaactgagctaa |
3481566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 60 - 122
Target Start/End: Original strand, 3693789 - 3693851
Alignment:
| Q |
60 |
gtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||| ||||||||| |||||| |||||||||||||||||| || || |||||||||| |||| |
|
|
| T |
3693789 |
gtggtcggggtttgaacctcagaccttacatatattatgctttgtctatatcaactgagctaa |
3693851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 68 - 118
Target Start/End: Original strand, 4806796 - 4806846
Alignment:
| Q |
68 |
ggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaa |
118 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| || ||| |||||||| |
|
|
| T |
4806796 |
ggtttgaacctcaaaccttacatatattatacattgtctctaccaactgaa |
4806846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 83 - 117
Target Start/End: Complemental strand, 10292981 - 10292947
Alignment:
| Q |
83 |
ccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
10292981 |
ccttacatatattatgcattgtccctatcaactga |
10292947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 34595943 - 34595877
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatcccta-tcaactgaactaa |
122 |
Q |
| |
|
|||||||||| |||||| ||| | ||||| ||||||||||||||||||| || ||||||||||||| |
|
|
| T |
34595943 |
gtggtggccgaggtttgaaccccggaccttgcatatattatgcattatccttagtcaactgaactaa |
34595877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 60 - 122
Target Start/End: Original strand, 41763148 - 41763210
Alignment:
| Q |
60 |
gtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||||||||| ||| | ||||| ||||| |||||||||||||||| ||||||| |||| |
|
|
| T |
41763148 |
gtggccggggtttgaaccccggaccttgcatattttatgcattatccctaccaactgagctaa |
41763210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 117
Target Start/End: Complemental strand, 42416852 - 42416814
Alignment:
| Q |
79 |
caaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
42416852 |
caaaccttgcatatattatgcattatccttatcaactga |
42416814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 121
Target Start/End: Original strand, 48639026 - 48639068
Alignment:
| Q |
79 |
caaaccttacatatattatgcattatccctatcaactgaacta |
121 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||| ||||||| |
|
|
| T |
48639026 |
caaaccttacatatattatgcattgtccctaacaattgaacta |
48639068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 84 - 117
Target Start/End: Original strand, 12852219 - 12852252
Alignment:
| Q |
84 |
cttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
12852219 |
cttacatatattatgcattatccctaccaactga |
12852252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 102
Target Start/End: Original strand, 16966962 - 16967007
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
||||||||||| ||||| ||||| |||||| ||||||||||||||| |
|
|
| T |
16966962 |
gtggtggccggagtttgaacctcgaaccttgcatatattatgcatt |
16967007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 25130194 - 25130129
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||| ||| ||||| || ||||||||||||||||||| ||| |||| ||| ||||||||||| |
|
|
| T |
25130194 |
gtggtggtcggagtttgaacatcaaaccttacatatattacgcactatcactactaactgaactaa |
25130129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 58 - 115
Target Start/End: Original strand, 33382249 - 33382306
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaact |
115 |
Q |
| |
|
|||||| ||||||||| || || |||||||||||||||| |||||||||||||||| |
|
|
| T |
33382249 |
tggtggtcggggtttgaacaccagaccttacatatattatttattatccctatcaact |
33382306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 102
Target Start/End: Complemental strand, 34083408 - 34083363
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
|||||||| |||||| | ||| |||||||||||||||||||||||| |
|
|
| T |
34083408 |
gtggtggctggggttcgaaccccaaaccttacatatattatgcatt |
34083363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Original strand, 42045362 - 42045427
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||||||||| || || ||||| ||||||||||||||| ||| || ||||||| |||| |
|
|
| T |
42045362 |
gtggtggccggggtttgaactccagaccttgcatatattatgcattgtccataccaactgagctaa |
42045427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 117
Target Start/End: Original strand, 3573334 - 3573374
Alignment:
| Q |
77 |
ctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||||||||||||||||||||||| | |||| ||||||| |
|
|
| T |
3573334 |
ctcaaaccttacatatattatgcattgttcctaccaactga |
3573374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 125
Target Start/End: Complemental strand, 9413845 - 9413801
Alignment:
| Q |
81 |
aaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||||||||||||||||||| | | || ||||||||||||||| |
|
|
| T |
9413845 |
aaccttacatatattatgcattgttcttaccaactgaactaaact |
9413801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 82 - 122
Target Start/End: Original strand, 10843336 - 10843376
Alignment:
| Q |
82 |
accttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||| |||| |
|
|
| T |
10843336 |
accttgcatatattatgcattatccttatcaactgagctaa |
10843376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 82 - 122
Target Start/End: Original strand, 13794523 - 13794563
Alignment:
| Q |
82 |
accttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||| |||| |
|
|
| T |
13794523 |
accttgcatatattatgcattatccttatcaactgagctaa |
13794563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 109
Target Start/End: Complemental strand, 14880899 - 14880847
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatcccta |
109 |
Q |
| |
|
||||| |||||| |||| |||||| ||||| ||||||||||||||| |||||| |
|
|
| T |
14880899 |
gtggttgccgggatttgaacctcagaccttgcatatattatgcattgtcccta |
14880847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 117
Target Start/End: Original strand, 30678827 - 30678863
Alignment:
| Q |
81 |
aaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
30678827 |
aaccttacatatattatgcattgtccctaccaactga |
30678863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 32923889 - 32923829
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||| ||| ||||| || ||| ||||| ||||||||||||||| |||||| ||||||| |
|
|
| T |
32923889 |
gtggtggtcggagtttgaacttcagacctttcatatattatgcattgtccctaccaactga |
32923829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 113
Target Start/End: Complemental strand, 33175332 - 33175276
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaa |
113 |
Q |
| |
|
|||||||| | | |||| |||||| ||||||||||||||||||||| ||| |||||| |
|
|
| T |
33175332 |
gtggtggctgagatttgaacctcataccttacatatattatgcattgtccatatcaa |
33175276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 34521180 - 34521248
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||||||| |||||| ||| | ||||| ||||||||||||||| ||| || ||||||| ||||||| |
|
|
| T |
34521180 |
gtggtggccgaggtttgaaccccggaccttgcatatattatgcattgtccataccaactgagctaaact |
34521248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 125
Target Start/End: Complemental strand, 43611487 - 43611427
Alignment:
| Q |
65 |
cggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||||||| ||| || ||||||||||||||||| ||| ||| || ||||||| ||||||| |
|
|
| T |
43611487 |
cggggtttgaaccccataccttacatatattatgtattgtccataccaactgagctaaact |
43611427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 125
Target Start/End: Complemental strand, 47070895 - 47070851
Alignment:
| Q |
81 |
aaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||| ||||||||||| ||| | |||||||||||||||||||| |
|
|
| T |
47070895 |
aaccttgcatatattatgtattgttcctatcaactgaactaaact |
47070851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 44)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 65 - 118
Target Start/End: Complemental strand, 45151440 - 45151387
Alignment:
| Q |
65 |
cggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaa |
118 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45151440 |
cggggtttgaaccccaaaccttacatatattatgcattattcctatcaactgaa |
45151387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 34000333 - 34000273
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||| |||| ||| | |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34000333 |
gtggtggccggtatttgaaccccgaaccttacatatattatgcattatccttatcaactga |
34000273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 82 - 125
Target Start/End: Original strand, 37451252 - 37451295
Alignment:
| Q |
82 |
accttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
37451252 |
accttacatatattatgcattatccttatcaactgagctaaact |
37451295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 122
Target Start/End: Original strand, 35142139 - 35142204
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||| ||||||| | ||||||||| || ||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
35142139 |
gtggtggtcggggttcgaacctcaaactttgcatatattatgcattgtccatatcaactgagctaa |
35142204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 16537526 - 16537594
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||| ||| |||||| ||| || ||||| ||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
16537526 |
gtggtgaccgaggtttgaaccccagaccttgtatatattatgcattatccctaccaactgagctaaact |
16537594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 125
Target Start/End: Complemental strand, 16628136 - 16628068
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||| ||| |||||| ||| || ||||| ||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
16628136 |
gtggtgaccgaggtttgaaccccagaccttgtatatattatgcattatccctaccaactgagctaaact |
16628068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 75 - 123
Target Start/End: Complemental strand, 34773284 - 34773236
Alignment:
| Q |
75 |
acctcaaaccttacatatattatgcattatccctatcaactgaactaaa |
123 |
Q |
| |
|
|||||| ||||| ||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
34773284 |
acctcataccttgcatatattatgcattgtccctaccaactgaactaaa |
34773236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 65 - 117
Target Start/End: Original strand, 40187634 - 40187686
Alignment:
| Q |
65 |
cggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||| ||| || ||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
40187634 |
cggggtttgaaccgcagaccttacatatattatgcattgtccctaccaactga |
40187686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 57 - 104
Target Start/End: Original strand, 2703447 - 2703494
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattat |
104 |
Q |
| |
|
||||||| ||||||||| |||||||| |||| |||||||||||||||| |
|
|
| T |
2703447 |
gtggtggtcggggtttgaacctcaaatcttatatatattatgcattat |
2703494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 57 - 124
Target Start/End: Original strand, 16577850 - 16577917
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaac |
124 |
Q |
| |
|
|||||||||| |||||| ||| || ||||| ||||||||||| ||| |||||| ||||||| |||||| |
|
|
| T |
16577850 |
gtggtggccgaggtttgaaccccagaccttgcatatattatgtattgtccctaccaactgagctaaac |
16577917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 57 - 124
Target Start/End: Complemental strand, 16587812 - 16587745
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaac |
124 |
Q |
| |
|
|||||||||| |||||| ||| || ||||| ||||||||||| ||| |||||| ||||||| |||||| |
|
|
| T |
16587812 |
gtggtggccgaggtttgaaccccagaccttgcatatattatgtattgtccctaccaactgagctaaac |
16587745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 57 - 120
Target Start/End: Original strand, 18773746 - 18773809
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaact |
120 |
Q |
| |
|
||||||| ||||||||| ||| | ||||||||||| ||||||||| ||| ||||||||||||| |
|
|
| T |
18773746 |
gtggtggtcggggtttgaaccccggaccttacatattttatgcattgtccatatcaactgaact |
18773809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 66 - 125
Target Start/End: Complemental strand, 35222986 - 35222927
Alignment:
| Q |
66 |
ggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||||| ||| || ||||| ||||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
35222986 |
ggggtttgaaccccagaccttgcatatatcatgcattgtccctatcaactgacctaaact |
35222927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 70 - 117
Target Start/End: Original strand, 44941416 - 44941463
Alignment:
| Q |
70 |
tttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||| |||| ||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
44941416 |
tttgaaccttaaaccttgcatatattatgcattatccctaccaactga |
44941463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 125
Target Start/End: Original strand, 10467128 - 10467174
Alignment:
| Q |
79 |
caaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||||| || ||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
10467128 |
caaaccttgcaaatattatgcattatccctaccaactgatctaaact |
10467174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 117
Target Start/End: Original strand, 21164766 - 21164808
Alignment:
| Q |
75 |
acctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||| || ||||||| |
|
|
| T |
21164766 |
acctcaaaccttatatatattatgcattatccataccaactga |
21164808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 80 - 122
Target Start/End: Original strand, 22288058 - 22288100
Alignment:
| Q |
80 |
aaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||| |||||||| |
|
|
| T |
22288058 |
aaaccttacatatattatgcattatcgctaccaattgaactaa |
22288100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 125
Target Start/End: Original strand, 31151923 - 31151969
Alignment:
| Q |
79 |
caaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||||| |||||||||| || |||| ||||||||||||||||||| |
|
|
| T |
31151923 |
caaaccttgcatatattatacaatatctctatcaactgaactaaact |
31151969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 5579764 - 5579699
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||| ||||||||| ||| || ||||| ||||||||||||| | |||||| ||||||| |||| |
|
|
| T |
5579764 |
gtggtggtcggggtttgaaccccagaccttgcatatattatgcactgtccctaccaactgagctaa |
5579699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 21105674 - 21105609
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||| ||||||| | ||||| |||||| ||||||||||||||| ||| || ||||||| |||| |
|
|
| T |
21105674 |
gtggtggtcggggttcgaacctcgaaccttgcatatattatgcattttccataccaactgagctaa |
21105609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Original strand, 22690026 - 22690091
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||| |||||||| | ||| |||||||| ||||||||||||||||| | || ||||||| |||| |
|
|
| T |
22690026 |
gtggtgtccggggttcgaaccccaaaccttgcatatattatgcattattcttagcaactgagctaa |
22690091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 81 - 122
Target Start/End: Original strand, 34568347 - 34568388
Alignment:
| Q |
81 |
aaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||| |||| |
|
|
| T |
34568347 |
aaccttgcatatattatgcattatccttatcaactgagctaa |
34568388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 102
Target Start/End: Original strand, 42227795 - 42227840
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
||||||| ||| ||||| ||||| |||||||||||||||||||||| |
|
|
| T |
42227795 |
gtggtggtcggagtttgaacctcgaaccttacatatattatgcatt |
42227840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 106
Target Start/End: Complemental strand, 48837938 - 48837889
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatcc |
106 |
Q |
| |
|
||||||||||||||| | ||| ||||| || ||||||||||||||||||| |
|
|
| T |
48837938 |
gtggtggccggggttcgaaccccaaactttgcatatattatgcattatcc |
48837889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 429168 - 429228
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||| ||||||| | || |||||||| ||||||||||| ||||||| |||||||||| |
|
|
| T |
429168 |
gtggtggtcggggttcggactccaaaccttgcatatattatgtattatccatatcaactga |
429228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 122
Target Start/End: Complemental strand, 5526795 - 5526731
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||| ||||||||| ||| |||| |||| |||||||||||||| ||| || ||||||| |||| |
|
|
| T |
5526795 |
tggtggtcggggtttgaaccccaaatcttatatatattatgcattgtccataccaactgagctaa |
5526731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 7388029 - 7388089
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||| ||||||||| | | | |||||||||||||||||||||| |||| | ||||||| |
|
|
| T |
7388029 |
gtggtggtcggggtttgaatcccgaaccttacatatattatgcattgtcccaaccaactga |
7388089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 125
Target Start/End: Complemental strand, 7908640 - 7908596
Alignment:
| Q |
81 |
aaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||||||||| ||||||||| ||| || ||||||||||||||| |
|
|
| T |
7908640 |
aaccttacatattttatgcattgtccataccaactgaactaaact |
7908596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 7994874 - 7994934
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||| ||||||||| ||| || ||||||||||||||||| || |||||| ||||||| |
|
|
| T |
7994874 |
gtggtggtcggggtttgaaccccagaccttacatatattatgttttgtccctaccaactga |
7994934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 125
Target Start/End: Complemental strand, 8227392 - 8227352
Alignment:
| Q |
85 |
ttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
8227392 |
ttacatatattatgcattgtccttatcaactgagctaaact |
8227352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 102
Target Start/End: Complemental strand, 9522982 - 9522938
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
|||||||||||||| | ||| |||||||| ||||||||||||||| |
|
|
| T |
9522982 |
tggtggccggggttcgaaccccaaaccttgcatatattatgcatt |
9522938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 122
Target Start/End: Complemental strand, 10424031 - 10423967
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||||||||| | |||||| |||||| ||||||||||| || ||| ||| |||||| |||| |
|
|
| T |
10424031 |
tggtggccggggttcgaacctcagaccttatatatattatgcgttgtccttatgaactgagctaa |
10423967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 20115572 - 20115640
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||| ||||||||| |||| |||||||||||| |||||||| |||||| ||||||| ||||||| |
|
|
| T |
20115572 |
gtggtgaccggggtttaaaccttgtaccttacatataatatgcattgtccctaccaactgagctaaact |
20115640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 122
Target Start/End: Original strand, 27068148 - 27068212
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||| ||||||| ||||||||| || |||||| |||||||||||| || ||||||| |||| |
|
|
| T |
27068148 |
tggtggctagggtttgaacctcaaactttgcatataatatgcattatccataccaactgagctaa |
27068212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 122
Target Start/End: Complemental strand, 27210165 - 27210101
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||| ||||||| ||||||||| || |||||| |||||||||||| || ||||||| |||| |
|
|
| T |
27210165 |
tggtggctagggtttgaacctcaaactttgcatataatatgcattatccataccaactgagctaa |
27210101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 66 - 122
Target Start/End: Original strand, 27279402 - 27279458
Alignment:
| Q |
66 |
ggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||| || || ||||||||||| |
|
|
| T |
27279402 |
ggggtttgaacctcaaaccttacatatattatacattgtctatactaactgaactaa |
27279458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 27462426 - 27462486
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||||||||| ||| | ||||| ||||||||||||||| ||| || ||||||| |
|
|
| T |
27462426 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaactga |
27462486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 27833391 - 27833451
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||| ||||||||| ||| | ||||||||||||||||||||| ||| || ||||||| |
|
|
| T |
27833391 |
gtggtggtcggggtttgaaccccggaccttacatatattatgcattgtccttaccaactga |
27833451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 102
Target Start/End: Complemental strand, 34897568 - 34897536
Alignment:
| Q |
70 |
tttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
34897568 |
tttgaacctcaaaccttacatatattatgcatt |
34897536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 39106653 - 39106721
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||||||| || |||| ||||| |||||| ||||| ||||||||||| | |||||||| || |||||| |
|
|
| T |
39106653 |
gtggtggccaggatttgaacctcgaaccttgcatattttatgcattattcatatcaacttaattaaact |
39106721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 113
Target Start/End: Complemental strand, 40854972 - 40854936
Alignment:
| Q |
77 |
ctcaaaccttacatatattatgcattatccctatcaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
40854972 |
ctcaaaccttacatatattatgcattttccttatcaa |
40854936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 42829224 - 42829284
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||| ||||| ||| | | ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
42829224 |
gtggtggccggagtttgaaccccggagcttgcatatattatgcattgtccctatcaactga |
42829284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 82 - 122
Target Start/End: Original strand, 43539119 - 43539159
Alignment:
| Q |
82 |
accttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||| |||| |
|
|
| T |
43539119 |
accttacatatattatgcattgttcctatcaactgagctaa |
43539159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 82 - 122
Target Start/End: Original strand, 48629080 - 48629120
Alignment:
| Q |
82 |
accttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||| ||||||||||||||| |||||| |||||||||||| |
|
|
| T |
48629080 |
accttgcatatattatgcattgtccctaacaactgaactaa |
48629120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 36)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 24623307 - 24623375
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||||| ||||||||| ||| | |||||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
24623307 |
gtggtggtcggggtttgaaccccgaaccttacatatattatgcattgtccatatcaactgagctaaact |
24623375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 60 - 122
Target Start/End: Complemental strand, 29069551 - 29069489
Alignment:
| Q |
60 |
gtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||||||||| |||||| || || ||||||||||||||| |||||||||||||| |||| |
|
|
| T |
29069551 |
gtggccggggtttgaacctcagacttttcatatattatgcattgtccctatcaactgagctaa |
29069489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 4826361 - 4826296
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||||||||||||||||| || ||| ||| |||||||| |
|
|
| T |
4826361 |
gtggtggccggagtttgaacctcgaaccttacatatattatgcattgtctctaccaattgaactaa |
4826296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 34701218 - 34701153
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||| ||||| |||||| ||||| ||||||||||||||| | |||| |||||||||||| |
|
|
| T |
34701218 |
gtggtggccggagtttgaacctcagaccttgcatatattatgcattgttcctaccaactgaactaa |
34701153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 125
Target Start/End: Complemental strand, 10018470 - 10018403
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||||||||| ||||| ||| | |||||||||||||||||||||||| |||| ||||||| ||||||| |
|
|
| T |
10018470 |
gtggtggccggagtttgaaccccgaaccttacatatattatgcattat-cctaccaactgagctaaact |
10018403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 104
Target Start/End: Complemental strand, 12306392 - 12306345
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattat |
104 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
12306392 |
gtggtggccggggtttgaacctcagaccttacatatattattcattat |
12306345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 57 - 115
Target Start/End: Original strand, 2617195 - 2617253
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaact |
115 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
2617195 |
gtggtggccgaggtttaaacctcaaaccttacatatattatgcattgtctctaccaact |
2617253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 122
Target Start/End: Original strand, 27907941 - 27908006
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||||||||| ||| || ||||| ||||| ||||||||||||| | |||||||| |||| |
|
|
| T |
27907941 |
gtggtggccggggtttgaaccccagaccttgcatattttatgcattatccttgtcaactgagctaa |
27908006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 97
Target Start/End: Original strand, 31682891 - 31682931
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattat |
97 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
31682891 |
gtggtggccggggtttgaacctcaaaccttacataaattat |
31682931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 58 - 125
Target Start/End: Complemental strand, 34828377 - 34828309
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacata-tattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||||||||||| | |||||| |||||||||| ||||||||||| ||| || ||||||| ||||||| |
|
|
| T |
34828377 |
tggtggccggggttcgaacctcagaccttacatattattatgcattgtccataccaactgagctaaact |
34828309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 67 - 122
Target Start/End: Original strand, 8637437 - 8637492
Alignment:
| Q |
67 |
gggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||| ||||| ||||| ||||||||||||||| |||||| |||||||||||| |
|
|
| T |
8637437 |
gggtttgaacctcggaccttgcatatattatgcattgtccctaccaactgaactaa |
8637492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 78 - 117
Target Start/End: Complemental strand, 12204419 - 12204380
Alignment:
| Q |
78 |
tcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
12204419 |
tcaaaccttacatatattatgcattgtccatatcaactga |
12204380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 58 - 117
Target Start/End: Complemental strand, 16390499 - 16390440
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||| |||||| ||| | ||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
16390499 |
tggtggccgaggtttgaaccccggaccttacatatattatgcattgtccctaccaactga |
16390440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 75 - 122
Target Start/End: Original strand, 28046186 - 28046233
Alignment:
| Q |
75 |
acctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||||||| ||||||||||||||| || ||||||||||||||| |
|
|
| T |
28046186 |
acctcaaaccttgcatatattatgcattgtctttatcaactgaactaa |
28046233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 66 - 105
Target Start/End: Complemental strand, 35110116 - 35110077
Alignment:
| Q |
66 |
ggggtttgtacctcaaaccttacatatattatgcattatc |
105 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
35110116 |
ggggttcgaacctcaaaccttacatatattatgcattatc |
35110077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 68 - 102
Target Start/End: Original strand, 1989044 - 1989078
Alignment:
| Q |
68 |
ggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
1989044 |
ggtttgaacctcaaaccttacatatattatgcatt |
1989078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 125
Target Start/End: Original strand, 30639434 - 30639484
Alignment:
| Q |
75 |
acctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| |||| ||||||| ||||||| |
|
|
| T |
30639434 |
acctcagaccttgcatatattatgcattattcctaccaactgagctaaact |
30639484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 88 - 125
Target Start/End: Original strand, 12031 - 12068
Alignment:
| Q |
88 |
catatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
12031 |
catatattatgcattatctctatcaactgagctaaact |
12068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 77 - 122
Target Start/End: Complemental strand, 3274052 - 3274007
Alignment:
| Q |
77 |
ctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||| |||||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
3274052 |
ctcaaactttacatatattatgcattgtccatatcaattgaactaa |
3274007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 81 - 122
Target Start/End: Complemental strand, 3487978 - 3487937
Alignment:
| Q |
81 |
aaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||| ||||||||||||||||| | ||||||||||||||| |
|
|
| T |
3487978 |
aaccttgcatatattatgcattattcttatcaactgaactaa |
3487937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 60 - 117
Target Start/End: Original strand, 9311923 - 9311980
Alignment:
| Q |
60 |
gtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||| ||||||||| |||||||| ||||||||||||||| ||||| | || ||||||| |
|
|
| T |
9311923 |
gtggtcggggtttgaacctcaaatcttacatatattatgtattattcataccaactga |
9311980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 102
Target Start/End: Original strand, 12735132 - 12735177
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
||||||| ||||||||| || ||||||||| ||||||||||||||| |
|
|
| T |
12735132 |
gtggtggtcggggtttggacatcaaaccttgcatatattatgcatt |
12735177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 14610051 - 14609987
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||||||||| ||| | |||||||||||||||| ||| |||||||||||||| |||| |
|
|
| T |
14610051 |
gtggtggccggggtttgaacc-cggaccttacatatattatagattgtccctatcaactgagctaa |
14609987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 102
Target Start/End: Complemental strand, 15170002 - 15169957
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
||||||| ||||||||| ||| | |||||||||||||||||||||| |
|
|
| T |
15170002 |
gtggtggtcggggtttgaaccccgaaccttacatatattatgcatt |
15169957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 102
Target Start/End: Complemental strand, 15178774 - 15178729
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
||||||| ||||||||| ||| | |||||||||||||||||||||| |
|
|
| T |
15178774 |
gtggtggtcggggtttgaaccccgaaccttacatatattatgcatt |
15178729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 122
Target Start/End: Complemental strand, 1535353 - 1535309
Alignment:
| Q |
78 |
tcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||| |||| ||||||||||||||| | ||||||||||||||||| |
|
|
| T |
1535353 |
tcaatccttgcatatattatgcattgttcctatcaactgaactaa |
1535309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 90 - 122
Target Start/End: Complemental strand, 7927738 - 7927706
Alignment:
| Q |
90 |
tatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
7927738 |
tatattatgcattgtccctatcaactgaactaa |
7927706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 9333970 - 9334030
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||| ||| |||| | ||| |||||||||||||||||||||||| ||| | |||||||| |
|
|
| T |
9333970 |
gtggtgtccgaggttcgaaccccaaaccttacatatattatgcattgtccttgtcaactga |
9334030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 102
Target Start/End: Complemental strand, 9973288 - 9973244
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
|||||||||| ||| | ||| |||||||||||||||||||||||| |
|
|
| T |
9973288 |
tggtggccggagttcgaaccccaaaccttacatatattatgcatt |
9973244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 14049874 - 14049934
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||| |||| |||||| ||||| ||||||||||||||| || | ||||||||| |
|
|
| T |
14049874 |
gtggtggccggaatttgaacctcagaccttgcatatattatgcattgtctcaatcaactga |
14049934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 28231415 - 28231475
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||| || || ||| | ||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
28231415 |
gtggtggccggagtgtgaaccccggaccttgcatatattatgcattgtccctatcaactga |
28231475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 125
Target Start/End: Complemental strand, 29457240 - 29457184
Alignment:
| Q |
69 |
gtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||| ||| ||||||||| |||||||||||||| | |||| ||||||| ||||||| |
|
|
| T |
29457240 |
gtttgaaccacaaaccttatatatattatgcatttttcctaccaactgagctaaact |
29457184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 113
Target Start/End: Complemental strand, 29680635 - 29680603
Alignment:
| Q |
81 |
aaccttacatatattatgcattatccctatcaa |
113 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
29680635 |
aaccttgcatatattatgcattatccctatcaa |
29680603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 82 - 122
Target Start/End: Original strand, 30370165 - 30370205
Alignment:
| Q |
82 |
accttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
30370165 |
accttacatatattatgcattatctttaccaactgaactaa |
30370205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 122
Target Start/End: Complemental strand, 32053858 - 32053794
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||||| ||||| ||| | |||||| ||||||||||||||| ||| || ||||||| |||| |
|
|
| T |
32053858 |
tggtggccggagtttgaaccacgaaccttgcatatattatgcattgtccataccaactgagctaa |
32053794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 122
Target Start/End: Complemental strand, 33824951 - 33824887
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||| |||||| ||| | ||||| ||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
33824951 |
tggtggccgaggtttgaaccccggaccttgcatatattatgcattgtccttatcaactgagctaa |
33824887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 44)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 58 - 125
Target Start/End: Complemental strand, 32006570 - 32006503
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||||||| ||||| ||| | ||| ||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
32006570 |
tggtggccggagtttgaaccccgaactttacatatattatgcattatccctaccaactgagctaaact |
32006503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 57 - 115
Target Start/End: Complemental strand, 9783970 - 9783912
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaact |
115 |
Q |
| |
|
|||||||||| |||||| |||||| ||||||||||||||||||||| ||| |||||||| |
|
|
| T |
9783970 |
gtggtggccgaggtttgaacctcagaccttacatatattatgcattgtccatatcaact |
9783912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 10564455 - 10564523
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||| ||||||||||| |||||| ||||||||||||||||| ||| ||| || ||||||| ||||||| |
|
|
| T |
10564455 |
gtggtagccggggtttgaacctcagaccttacatatattatgtattgtccataccaactgagctaaact |
10564523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 43034332 - 43034392
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||||||||| |||||| ||||| ||||||||||||||| ||| || ||||||| |
|
|
| T |
43034332 |
gtggtggccggggtttgaacctcagaccttgcatatattatgcattgtccataccaactga |
43034392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 69 - 117
Target Start/End: Original strand, 46434762 - 46434810
Alignment:
| Q |
69 |
gtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
46434762 |
gtttgaacctcaaaccttacatatattatgcattgtccttatcaactga |
46434810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 75 - 117
Target Start/End: Original strand, 39842020 - 39842062
Alignment:
| Q |
75 |
acctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
39842020 |
acctcaaaccttacatatattatgcattgtccttatcaactga |
39842062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 79 - 117
Target Start/End: Complemental strand, 54587949 - 54587911
Alignment:
| Q |
79 |
caaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
54587949 |
caaaccttacatatattatgcattatccatatcaactga |
54587911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 60 - 117
Target Start/End: Complemental strand, 11300743 - 11300686
Alignment:
| Q |
60 |
gtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||| |||||||| |||| |||||||||| |
|
|
| T |
11300743 |
gtggccggggtttgaacctcggaccttacatatgttatgcataatccatatcaactga |
11300686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 61 - 122
Target Start/End: Original strand, 21623413 - 21623474
Alignment:
| Q |
61 |
tggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||| ||||| |||||| ||||| ||||||||||||||| |||||| |||||||||||| |
|
|
| T |
21623413 |
tggccgaggtttaaacctcagaccttgcatatattatgcattgtccctaccaactgaactaa |
21623474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 122
Target Start/End: Original strand, 56551582 - 56551647
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||||||||| ||||| ||||| ||||||||||||||| ||| || ||||||| |||| |
|
|
| T |
56551582 |
gtggtggccggggtttgaacctcggaccttgcatatattatgcattgtccttaccaactgagctaa |
56551647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 18903748 - 18903816
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||||| | ||||||| ||| || ||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
18903748 |
gtggtggtcagggtttgaaccccagaccttacatatattatgcattatttttatcaactgagctaaact |
18903816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 28435238 - 28435306
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||||| |||||||| ||| | |||||| ||||||||||||||| ||| || ||||||| ||||||| |
|
|
| T |
28435238 |
gtggtggctggggtttgaaccccgaaccttgcatatattatgcattgtccataccaactgagctaaact |
28435306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 30135211 - 30135151
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||| ||||||||| ||||| | || |||||||||||||||||||| |||||||||| |
|
|
| T |
30135211 |
gtggtggtcggggtttgaacctcggatctgacatatattatgcattatccttatcaactga |
30135151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 35305307 - 35305247
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||| ||||||||| || ||||||||| |||||||| |||||||| ||||||||||| |
|
|
| T |
35305307 |
gtggtggtcggggtttgaacttcaaaccttgcatatattgtgcattatttctatcaactga |
35305247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 113
Target Start/End: Complemental strand, 54677296 - 54677240
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaa |
113 |
Q |
| |
|
||||||||||| ||||| | ||| |||||||||||||||||||||| ||| |||||| |
|
|
| T |
54677296 |
gtggtggccggagtttgaatctcgaaccttacatatattatgcattgtccatatcaa |
54677240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 58 - 125
Target Start/End: Original strand, 22164260 - 22164327
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||| ||||||||| ||| || ||||||||||||||||||||| | |||| ||||| | ||||||| |
|
|
| T |
22164260 |
tggtggtcggggtttgaaccccagaccttacatatattatgcattgttcctaccaactaagctaaact |
22164327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 58 - 117
Target Start/End: Original strand, 22630351 - 22630410
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||| ||||||||| |||||| ||||| ||||||||||||||| || ||| ||||||| |
|
|
| T |
22630351 |
tggtggtcggggtttgaacctcagaccttgcatatattatgcattgtcactaccaactga |
22630410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 84 - 123
Target Start/End: Original strand, 31327660 - 31327699
Alignment:
| Q |
84 |
cttacatatattatgcattatccctatcaactgaactaaa |
123 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
31327660 |
cttatatatattatgcaatatccctatcaactgaactaaa |
31327699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 125
Target Start/End: Complemental strand, 22040711 - 22040653
Alignment:
| Q |
67 |
gggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||||| ||| | |||||| ||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
22040711 |
gggtttgaaccccgaaccttgcatatattatgcattgtccatatcaactgagctaaact |
22040653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 61 - 103
Target Start/End: Original strand, 34968003 - 34968045
Alignment:
| Q |
61 |
tggccggggtttgtacctcaaaccttacatatattatgcatta |
103 |
Q |
| |
|
|||||| |||| | ||||||||||||||||||||||||||||| |
|
|
| T |
34968003 |
tggccgaggttcgaacctcaaaccttacatatattatgcatta |
34968045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 115
Target Start/End: Complemental strand, 38375028 - 38374970
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaact |
115 |
Q |
| |
|
||||||||||||||||| || || ||||| ||||||||||||||| |||||| ||||| |
|
|
| T |
38375028 |
gtggtggccggggtttgaactccagaccttgcatatattatgcattgtccctaccaact |
38374970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 104
Target Start/End: Original strand, 49716930 - 49716976
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattat |
104 |
Q |
| |
|
||||| |||||||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
49716930 |
tggtgtccggggttagaacctcaaaccttgcatatattatgcattat |
49716976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 102
Target Start/End: Complemental strand, 5534011 - 5533966
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||||||| |||||||| |
|
|
| T |
5534011 |
gtggtggccgggatttgaacctcagaccttacatatactatgcatt |
5533966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 58 - 115
Target Start/End: Complemental strand, 13121614 - 13121557
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaact |
115 |
Q |
| |
|
|||| ||||||||||| || ||| ||||| ||||||||||||||| |||||| ||||| |
|
|
| T |
13121614 |
tggtagccggggtttgaacttcagaccttgcatatattatgcattgtccctaccaact |
13121557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 60 - 117
Target Start/End: Original strand, 14202472 - 14202529
Alignment:
| Q |
60 |
gtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||| ||||||||| ||| | ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14202472 |
gtggtcggggtttgaaccccggaccttacatatattatgcattatccaaatcaactga |
14202529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 27655801 - 27655737
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||||||| | ||| || ||||| ||||||||||||||| | |||||||||||||||| |
|
|
| T |
27655801 |
gtggtggccggggttcgaacc-cagaccttgcatatattatgcattgtttctatcaactgaactaa |
27655737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 102
Target Start/End: Original strand, 37930837 - 37930882
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
||||||| ||||||||| |||||| ||||| ||||||||||||||| |
|
|
| T |
37930837 |
gtggtggtcggggtttgaacctcagaccttgcatatattatgcatt |
37930882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 65 - 122
Target Start/End: Complemental strand, 43155142 - 43155085
Alignment:
| Q |
65 |
cggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||| |||||| | ||| ||||||||||||||||||| || ||||||| |||| |
|
|
| T |
43155142 |
cggggtttgaacctcagatcttgcatatattatgcattatccataacaactgagctaa |
43155085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 82 - 125
Target Start/End: Complemental strand, 1701655 - 1701611
Alignment:
| Q |
82 |
accttacatatattatgcatt-atccctatcaactgaactaaact |
125 |
Q |
| |
|
||||| ||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
1701655 |
accttgcatatattatgcatttatccttatcaactgaactaaact |
1701611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 2034085 - 2034153
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||| ||| | |||| ||| || |||||| |||||||||||||||||| || ||||||| ||||||| |
|
|
| T |
2034085 |
gtggtgtccgagatttgaaccccagaccttaaatatattatgcattatccataccaactgagctaaact |
2034153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 66 - 102
Target Start/End: Original strand, 3299093 - 3299129
Alignment:
| Q |
66 |
ggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
3299093 |
ggggtttgaacctcaaaccttgcatatattatgcatt |
3299129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 117
Target Start/End: Original strand, 4911603 - 4911650
Alignment:
| Q |
69 |
gtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||| |||||| ||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
4911603 |
gtttgaacctcagaccttacatatattatgca-tatccttatcaactga |
4911650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 102
Target Start/End: Complemental strand, 4916225 - 4916181
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
|||||||| ||||||| ||| |||| ||||||||||||||||||| |
|
|
| T |
4916225 |
tggtggccagggtttgaaccccaaatcttacatatattatgcatt |
4916181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 122
Target Start/End: Complemental strand, 6087817 - 6087753
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||| |||||||| ||| || ||||| |||||||||||||||||| || ||||||| |||| |
|
|
| T |
6087817 |
tggtggctggggtttgaaccccagaccttgcatatattatgcattatctataccaactgagctaa |
6087753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 8027387 - 8027455
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||||| ||||||||| ||| | | ||| ||||||||||||||||||| || ||||||| ||||||| |
|
|
| T |
8027387 |
gtggtggtcggggtttgaacccccgatcttgcatatattatgcattatccttaccaactgagctaaact |
8027455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 125
Target Start/End: Complemental strand, 12263323 - 12263255
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||| |||| |||| |||||| |||||||||||||||| |||| ||| | |||||||| ||||||| |
|
|
| T |
12263323 |
gtggtgcccggattttgaacctcagaccttacatatattatacattgtccttgtcaactgagctaaact |
12263255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 113
Target Start/End: Complemental strand, 16703087 - 16703031
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaa |
113 |
Q |
| |
|
||||||| |||||||| | |||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
16703087 |
gtggtggttggggtttgaatctcataccttacatatattattcattatccatatcaa |
16703031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 21318243 - 21318303
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||| ||||||||| ||| | ||||| ||||||||||||||| |||||| ||||||| |
|
|
| T |
21318243 |
gtggtggtcggggtttgaaccctagaccttgcatatattatgcattgtccctaccaactga |
21318303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 117
Target Start/End: Complemental strand, 23160099 - 23160051
Alignment:
| Q |
69 |
gtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
23160099 |
gtttgaacctcggaccttacatatattatgcattgtccctaccaactga |
23160051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 125
Target Start/End: Complemental strand, 36071191 - 36071147
Alignment:
| Q |
81 |
aaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||||||||||||||||||| ||| || ||||||| ||||||| |
|
|
| T |
36071191 |
aaccttacatatattatgcattgtccttaccaactgacctaaact |
36071147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 82 - 122
Target Start/End: Original strand, 50442762 - 50442802
Alignment:
| Q |
82 |
accttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||| |||| |
|
|
| T |
50442762 |
accttgcatatattatgcattatccctaccaactgagctaa |
50442802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 117
Target Start/End: Complemental strand, 52936700 - 52936652
Alignment:
| Q |
69 |
gtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||| | ||||||||||| |
|
|
| T |
52936700 |
gtttgaacctcaaaccttacatatattatacattgtttctatcaactga |
52936652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 53617905 - 53617845
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||| ||||||||| || || |||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
53617905 |
gtggtggtcggggtttgaacagcagaccttaaatatattatgcattgtccctaccaactga |
53617845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 117
Target Start/End: Complemental strand, 56096251 - 56096215
Alignment:
| Q |
81 |
aaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
56096251 |
aaccttacatatattatgcattgtccttatcaactga |
56096215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 32)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 66 - 125
Target Start/End: Complemental strand, 31463546 - 31463487
Alignment:
| Q |
66 |
ggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
31463546 |
ggggtttgaacctcagaccttacatatattatgcattatttctatcaactgaactgaact |
31463487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 8075856 - 8075796
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||||||||| |||||| ||||| ||||||||||||||| || |||| |||||| |
|
|
| T |
8075856 |
gtggtggccggggtttgaacctcagaccttgcatatattatgcattgtctctattaactga |
8075796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 37920988 - 37921056
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||| ||||| |||| ||| || || || |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37920988 |
gtggtgtccgggatttgaaccgcagacattgcatatattatgcattatccctatcaactgagctaaact |
37921056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 118
Target Start/End: Original strand, 1456530 - 1456591
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaa |
118 |
Q |
| |
|
|||||||||| | |||| |||||| ||||| |||||||||| |||| ||||||||||||||| |
|
|
| T |
1456530 |
gtggtggccgagttttgaacctcagaccttgcatatattatacattgtccctatcaactgaa |
1456591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 122
Target Start/End: Original strand, 25441490 - 25441555
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||||||||| ||| || ||||| ||||||||||||||| ||| || ||||||| |||| |
|
|
| T |
25441490 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccataccaactgagctaa |
25441555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 7464481 - 7464541
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||| ||||||||| ||| | ||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
7464481 |
gtggtggtcggggtttgaaccccggaccttacatatattatgcattgtccctaccaactga |
7464541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 85 - 125
Target Start/End: Complemental strand, 12408221 - 12408181
Alignment:
| Q |
85 |
ttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
12408221 |
ttacatatattatgcattgtccctaccaactgaactaaact |
12408181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 121
Target Start/End: Original strand, 19126667 - 19126731
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaacta |
121 |
Q |
| |
|
||||||||| || |||| ||| |||||||||||||| ||||||||| ||| || ||||||||||| |
|
|
| T |
19126667 |
gtggtggccaggatttgaaccccaaaccttacatattttatgcattgtccataccaactgaacta |
19126731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 58 - 122
Target Start/End: Complemental strand, 30200896 - 30200832
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||| |||||||| | |||||||||||| ||||||||||||||| ||| || ||||||| |||| |
|
|
| T |
30200896 |
tggtgtccggggttcgaacctcaaaccttgcatatattatgcattgtccttagcaactgagctaa |
30200832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 48209201 - 48209269
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||||| ||||||||| ||| ||||||| |||||||||| ||| |||||||||||||| ||||||| |
|
|
| T |
48209201 |
gtggtggtcggggtttgaaccctgaaccttatatatattatgtattgtccctatcaactgagctaaact |
48209269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 75 - 122
Target Start/End: Complemental strand, 5117261 - 5117214
Alignment:
| Q |
75 |
acctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||| |||||||||| |||| |
|
|
| T |
5117261 |
acctcaaaccttacatatattatgtattgtccttatcaactgagctaa |
5117214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 82 - 117
Target Start/End: Complemental strand, 21160098 - 21160063
Alignment:
| Q |
82 |
accttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
21160098 |
accttacatatattatgcattatccatatcaactga |
21160063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 66 - 117
Target Start/End: Complemental strand, 35557155 - 35557104
Alignment:
| Q |
66 |
ggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||||| ||| || ||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
35557155 |
ggggtttgaaccccagaccttacatattttatgcattatcccaatcaactga |
35557104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 57 - 92
Target Start/End: Complemental strand, 42548003 - 42547968
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatat |
92 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42548003 |
gtggtggccggggtttgaacctcaaaccttacatat |
42547968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 60 - 102
Target Start/End: Original strand, 20612270 - 20612312
Alignment:
| Q |
60 |
gtggccggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
|||||||||||||| ||| |||||||| ||||||||||||||| |
|
|
| T |
20612270 |
gtggccggggtttgaaccccaaaccttgcatatattatgcatt |
20612312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 88 - 118
Target Start/End: Complemental strand, 25016392 - 25016362
Alignment:
| Q |
88 |
catatattatgcattatccctatcaactgaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
25016392 |
catatattatgcattatccctatcaactgaa |
25016362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 100
Target Start/End: Original strand, 45885468 - 45885510
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgca |
100 |
Q |
| |
|
|||||||||||||||| |||||| ||||| ||||||||||||| |
|
|
| T |
45885468 |
tggtggccggggtttgaacctcagaccttgcatatattatgca |
45885510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 60 - 117
Target Start/End: Original strand, 1111834 - 1111891
Alignment:
| Q |
60 |
gtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||| ||||||||| ||| || ||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
1111834 |
gtggtcggggtttgaaccccagaccttgcatatattatgtattgtccctatcaactga |
1111891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 64 - 117
Target Start/End: Complemental strand, 2563993 - 2563940
Alignment:
| Q |
64 |
ccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||| |||||| |||||||||| |
|
|
| T |
2563993 |
ccggggtttgaacctcgaaccttacatatattattcattatttttatcaactga |
2563940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 29631257 - 29631192
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||||||||| | | | |||||| ||||||||||||||| ||| || ||||||| |||| |
|
|
| T |
29631257 |
gtggtggccggggtttgaatcccgaaccttgcatatattatgcattgtccataccaactgagctaa |
29631192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 45432019 - 45431954
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||| ||||||| ||| | ||||| ||||||||||||||| |||||| ||||||| |||| |
|
|
| T |
45432019 |
gtggtggccagggtttgaaccccggaccttgcatatattatgcattgtccctaccaactgagctaa |
45431954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 64 - 125
Target Start/End: Original strand, 54230096 - 54230157
Alignment:
| Q |
64 |
ccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||||| | ||| |||||||| ||||||||||||||| ||| || ||||||| ||||||| |
|
|
| T |
54230096 |
ccggggttcgaaccccaaaccttgcatatattatgcattgtccttaccaactgagctaaact |
54230157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Original strand, 55066590 - 55066655
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||||||| |||| ||| || ||| | ||||||||||||||||||| || ||||||| |||| |
|
|
| T |
55066590 |
gtggtggccgggatttgaaccccagaccatgcatatattatgcattatccgtaccaactgagctaa |
55066655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 7651257 - 7651197
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||| ||| ||||| ||| | ||||||| ||||| |||||||| |||||||||||||| |
|
|
| T |
7651257 |
gtggtggtcggcgtttgaaccccgaaccttatatatactatgcattgtccctatcaactga |
7651197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 102
Target Start/End: Original strand, 28965768 - 28965812
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
||||| |||||||||| ||| | |||||||||||||||||||||| |
|
|
| T |
28965768 |
tggtgaccggggtttgaaccccgaaccttacatatattatgcatt |
28965812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 29791847 - 29791787
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||| | |||| |||||||||||||||||||||||| ||| | ||||||||||| |
|
|
| T |
29791847 |
gtggtggccaagatttgaacctcaaaccttacatatattatgtattgtttctatcaactga |
29791787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 122
Target Start/End: Complemental strand, 33404286 - 33404234
Alignment:
| Q |
70 |
tttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||| ||||||||| |||||||||||||| ||| ||| |||||||||| |||| |
|
|
| T |
33404286 |
tttgaacctcaaactttacatatattatgtattgtccatatcaactgagctaa |
33404234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 38130949 - 38131009
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||||||||| ||| | ||||| ||||||||||||||| ||| || ||||||| |
|
|
| T |
38130949 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccataccaactga |
38131009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 102
Target Start/End: Original strand, 43630421 - 43630453
Alignment:
| Q |
70 |
tttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
43630421 |
tttgaacctcaaaccttacatatattatgcatt |
43630453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 122
Target Start/End: Complemental strand, 48376901 - 48376841
Alignment:
| Q |
62 |
ggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||| || | ||| ||||||||||||||||||||||||||| || ||||||| |||| |
|
|
| T |
48376901 |
ggccgggattcgaaccccaaaccttacatatattatgcattatctttaccaactgagctaa |
48376841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 48657807 - 48657875
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||||| ||||||| | ||| | || ||||||||||||||| ||| |||||||||||| | ||||||| |
|
|
| T |
48657807 |
gtggtggtcggggttcgaaccccgaatcttacatatattatggattgtccctatcaactaagctaaact |
48657875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 122
Target Start/End: Complemental strand, 52119446 - 52119382
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||||||||| | ||| | |||||| ||||||||||||||| ||| || ||||||| |||| |
|
|
| T |
52119446 |
tggtggccggggttcgaaccccgaaccttgcatatattatgcattgtccttaccaactgagctaa |
52119382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 28)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 59 - 117
Target Start/End: Complemental strand, 16094126 - 16094068
Alignment:
| Q |
59 |
ggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||| ||||||||| ||| || | |||||||||||||||||||||||||||||||||| |
|
|
| T |
16094126 |
ggtggtcggggtttgaaccccagatcttacatatattatgcattatccctatcaactga |
16094068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 68 - 122
Target Start/End: Original strand, 21657399 - 21657453
Alignment:
| Q |
68 |
ggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
21657399 |
ggtttgaacctcaaaccttacatatattatgcattgtccctacaaactgaactaa |
21657453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 6489078 - 6489013
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||||||||| ||| || ||||| ||||||||||||||| |||||| ||||||| |||| |
|
|
| T |
6489078 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaa |
6489013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 29695086 - 29695026
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||| ||||||||| ||| | |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
29695086 |
gtggtggtcggggtttgaaccacgaaccttacatatattatgcattgtccatatcaactga |
29695026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 75 - 125
Target Start/End: Complemental strand, 11017229 - 11017179
Alignment:
| Q |
75 |
acctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
11017229 |
acctcagaccttgcatatattatgcattatccctaccaactgagctaaact |
11017179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 106
Target Start/End: Complemental strand, 3052252 - 3052203
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatcc |
106 |
Q |
| |
|
|||||||| ||| |||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
3052252 |
gtggtggctgggatttgaaccccaaaccttacatatattatgcattatcc |
3052203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 11156908 - 11156843
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||| | ||||| |||||||||||| |||||||||| ||||||| || |||||||||||| |
|
|
| T |
11156908 |
gtggtggccagagtttgaacctcaaaccttgtatatattatgtattatccataacaactgaactaa |
11156843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 109
Target Start/End: Original strand, 17083583 - 17083635
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatcccta |
109 |
Q |
| |
|
|||||||| |||||||| || || |||||||||||||||||||||||||||| |
|
|
| T |
17083583 |
gtggtggctggggtttgaactccagaccttacatatattatgcattatcccta |
17083635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 37054259 - 37054327
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||||| ||| ||||| ||| | ||||||| |||||||||||||| |||||| ||||||| ||||||| |
|
|
| T |
37054259 |
gtggtggtcggagtttgaaccccgaaccttatatatattatgcattgtccctaccaactgagctaaact |
37054327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 82 - 117
Target Start/End: Complemental strand, 5614811 - 5614776
Alignment:
| Q |
82 |
accttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5614811 |
accttacatatattatgcattatccatatcaactga |
5614776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 70 - 117
Target Start/End: Original strand, 5974228 - 5974275
Alignment:
| Q |
70 |
tttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||| |||||| ||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
5974228 |
tttgaacctcagaccttgcatatattatgcattatccctatcgactga |
5974275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 117
Target Start/End: Original strand, 23118063 - 23118101
Alignment:
| Q |
79 |
caaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
23118063 |
caaaccttacatatattatgcattgtccttatcaactga |
23118101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 68 - 122
Target Start/End: Complemental strand, 28344614 - 28344560
Alignment:
| Q |
68 |
ggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||| ||| |||||||| |||||||||| |||| ||||| ||||||||||||| |
|
|
| T |
28344614 |
ggtttgaaccccaaaccttgcatatattatacattgtccctttcaactgaactaa |
28344560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Original strand, 9893661 - 9893726
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||| |||||||| ||| || ||||| ||||| |||||||||||| |||||||||| |||| |
|
|
| T |
9893661 |
gtggtggctggggtttgaaccccagaccttgcatattttatgcattatctatatcaactgagctaa |
9893726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 60 - 97
Target Start/End: Original strand, 14589791 - 14589828
Alignment:
| Q |
60 |
gtggccggggtttgtacctcaaaccttacatatattat |
97 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
14589791 |
gtggccgggatttgaacctcaaaccttacatatattat |
14589828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 81 - 122
Target Start/End: Original strand, 15774011 - 15774052
Alignment:
| Q |
81 |
aaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
15774011 |
aaccttacatatattatgcattatctataccaactgaactaa |
15774052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 15889482 - 15889417
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||| ||||||||| ||| | ||||| ||||||||||||||| |||||| ||||||| |||| |
|
|
| T |
15889482 |
gtggtggtcggggtttgaaccctagaccttgcatatattatgcattgtccctaccaactgagctaa |
15889417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 77 - 122
Target Start/End: Original strand, 20370140 - 20370185
Alignment:
| Q |
77 |
ctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||| |||| |
|
|
| T |
20370140 |
ctcaaaccttgtatatattatgcattatccctaccaactgagctaa |
20370185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 32565595 - 32565530
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||| |||||| || || |||||||||||||||||||||||||||| || |||| |||| |
|
|
| T |
32565595 |
gtggtggccaaggtttgaacttcggaccttacatatattatgcattatccctaccagctgagctaa |
32565530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Original strand, 37791153 - 37791218
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||| ||||| ||||| |||||| |||||||||||| || | ||| |||||||||||| |
|
|
| T |
37791153 |
gtggtggccggagtttgaacctcgaaccttgcatatattatgcgttgtttctaccaactgaactaa |
37791218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 75 - 124
Target Start/End: Complemental strand, 39143767 - 39143718
Alignment:
| Q |
75 |
acctcaaaccttacatatattatgcattatccctatcaactgaactaaac |
124 |
Q |
| |
|
|||||||||||||||||||||||||| | ||| || ||||||| |||||| |
|
|
| T |
39143767 |
acctcaaaccttacatatattatgcaatgtccataccaactgagctaaac |
39143718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Original strand, 40715939 - 40716004
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||||||||| ||| | ||||| ||||||||||||||| ||| |||||| ||| |||| |
|
|
| T |
40715939 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccatatcaattgagctaa |
40716004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 125
Target Start/End: Complemental strand, 5591307 - 5591263
Alignment:
| Q |
81 |
aaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||| ||||||||||| |||||| ||| ||||||||||||||| |
|
|
| T |
5591307 |
aaccttccatatattatgtattatctctaccaactgaactaaact |
5591263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 11720964 - 11720905
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||||||||| ||| | | |||| ||||||||||||||| |||||| ||||||| |
|
|
| T |
11720964 |
gtggtggccggggtttgaaccccga-ccttgcatatattatgcattgtccctaccaactga |
11720905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 122
Target Start/End: Complemental strand, 22394105 - 22394041
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||| || ||||| ||||| | ||||||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
22394105 |
tggtggcaggagtttgaacctcggatcttacatatattatgcattgtccatatcaactgagctaa |
22394041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 26655535 - 26655475
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||||||| | ||| | ||||||||||||||||||||| ||| || ||||||| |
|
|
| T |
26655535 |
gtggtggccggggttcgaaccccggaccttacatatattatgcattgtccataccaactga |
26655475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 26927120 - 26927060
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||||||| | ||| | ||||||||||||||||||||| ||| || ||||||| |
|
|
| T |
26927120 |
gtggtggccggggttcgaaccccggaccttacatatattatgcattgtccataccaactga |
26927060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 113
Target Start/End: Original strand, 41630102 - 41630158
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaa |
113 |
Q |
| |
|
|||||| |||||||||| | | | |||||| ||||||||||||||| |||||||||| |
|
|
| T |
41630102 |
gtggtgaccggggtttgaatcccgaaccttgcatatattatgcattgtccctatcaa |
41630158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 51)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 57 - 115
Target Start/End: Original strand, 41939098 - 41939156
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaact |
115 |
Q |
| |
|
||||||| ||| ||||| | ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41939098 |
gtggtggtcggagtttgaatctcaaaccttacatatattatgcattatccctaccaact |
41939156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 61 - 122
Target Start/End: Complemental strand, 5028923 - 5028862
Alignment:
| Q |
61 |
tggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||| ||| ||||||||| |||| |
|
|
| T |
5028923 |
tggccggggtttgaaccccaaaccttacatatattatgcattgtcctaatcaactgagctaa |
5028862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 57 - 122
Target Start/End: Original strand, 24592836 - 24592901
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||||||||| ||| || ||||| ||||||||||||||| |||||| ||||||| |||| |
|
|
| T |
24592836 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaa |
24592901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 65 - 117
Target Start/End: Original strand, 5168577 - 5168629
Alignment:
| Q |
65 |
cggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||| ||| | |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5168577 |
cggggtttgaaccccgaaccttgcatatattatgcattatccctatcaactga |
5168629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 9547399 - 9547459
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||| ||||||||| ||| |||||||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
9547399 |
gtggtggtcggggtttgaaccccaaaccttgcatatattatgcattgtccatatcaactga |
9547459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 29896284 - 29896352
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||||| ||||||||| ||| |||||||| ||||||||||||||| | |||||||||||| |||||| |
|
|
| T |
29896284 |
gtggtggtcggggtttgaaccccaaaccttgcatatattatgcattgtttctatcaactgaattaaact |
29896352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 57 - 103
Target Start/End: Complemental strand, 10724010 - 10723964
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcatta |
103 |
Q |
| |
|
||||||||||||||||| |||||| ||||| |||||||||||||||| |
|
|
| T |
10724010 |
gtggtggccggggtttgaacctcagaccttgcatatattatgcatta |
10723964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 81 - 122
Target Start/End: Complemental strand, 17394721 - 17394680
Alignment:
| Q |
81 |
aaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
17394721 |
aaccttacatatattatgtattattcctatcaactgaactaa |
17394680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 26999181 - 26999116
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||| ||||| ||| || ||||| ||||||||||||||| || ||| |||||||||||| |
|
|
| T |
26999181 |
gtggtggccggagtttgaaccgcagaccttgcatatattatgcattgtctctaccaactgaactaa |
26999116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 68 - 117
Target Start/End: Original strand, 40967372 - 40967421
Alignment:
| Q |
68 |
ggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
40967372 |
ggtttgaacctcaaaccttgcatatattatgcattgtccttatcaactga |
40967421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 67 - 115
Target Start/End: Complemental strand, 3904263 - 3904215
Alignment:
| Q |
67 |
gggtttgtacctcaaaccttacatatattatgcattatccctatcaact |
115 |
Q |
| |
|
||||||| ||| || ||||||||||||||||||||| |||||||||||| |
|
|
| T |
3904263 |
gggtttgaaccccagaccttacatatattatgcattgtccctatcaact |
3904215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 25186232 - 25186300
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||||| |||||||| ||| | ||||| ||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
25186232 |
gtggtggctggggtttgaaccccggaccttgcatatattatgcattgtccatatcaactgagctaaact |
25186300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 82 - 122
Target Start/End: Complemental strand, 28202343 - 28202303
Alignment:
| Q |
82 |
accttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
28202343 |
accttacatatattatgcattgtccctatcaactgagctaa |
28202303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 81 - 125
Target Start/End: Original strand, 44488024 - 44488068
Alignment:
| Q |
81 |
aaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||||||||||||||||||| ||| || ||||||||||||||| |
|
|
| T |
44488024 |
aaccttacatatattatgcattgtccttaccaactgaactaaact |
44488068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 70 - 117
Target Start/End: Original strand, 25603914 - 25603961
Alignment:
| Q |
70 |
tttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||| ||| ||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
25603914 |
tttgaaccccaaaccttatatatattatgcattgtccctatcaactga |
25603961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 57 - 116
Target Start/End: Original strand, 35065618 - 35065677
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactg |
116 |
Q |
| |
|
||||||||||||||||| ||||| |||||| |||||||||| ||| | ||||||||||| |
|
|
| T |
35065618 |
gtggtggccggggtttgaacctcgaaccttgcatatattattgattgttcctatcaactg |
35065677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 57 - 100
Target Start/End: Complemental strand, 42451504 - 42451461
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgca |
100 |
Q |
| |
|
||||||| ||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
42451504 |
gtggtggtcggagtttgaacctcaaaccttacatatattatgca |
42451461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 66 - 125
Target Start/End: Original strand, 43117189 - 43117248
Alignment:
| Q |
66 |
ggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||||| |||||| ||||| ||||||||||||||| ||| || ||||||| ||||||| |
|
|
| T |
43117189 |
ggggtttgaacctcagaccttgcatatattatgcattgtccttaccaactgagctaaact |
43117248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 98
Target Start/End: Complemental strand, 12126933 - 12126899
Alignment:
| Q |
64 |
ccggggtttgtacctcaaaccttacatatattatg |
98 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
12126933 |
ccggggtttgaacctcaaaccttacatatattatg |
12126899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 84 - 122
Target Start/End: Complemental strand, 31156857 - 31156819
Alignment:
| Q |
84 |
cttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
31156857 |
cttacatatattatgcattatccctaccaactgagctaa |
31156819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 123
Target Start/End: Complemental strand, 31477042 - 31476976
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaa |
123 |
Q |
| |
|
|||||||||||| |||| ||| | |||||| |||||||||||||| |||||| ||||||| ||||| |
|
|
| T |
31477042 |
gtggtggccgggatttgaaccccgaaccttgtatatattatgcattctccctaccaactgagctaaa |
31476976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 81 - 122
Target Start/End: Complemental strand, 2429063 - 2429022
Alignment:
| Q |
81 |
aaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||||||||||||||||| ||| || |||||||||||| |
|
|
| T |
2429063 |
aaccttacatatattatgcattgtccttaccaactgaactaa |
2429022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 61 - 122
Target Start/End: Original strand, 4927443 - 4927504
Alignment:
| Q |
61 |
tggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||||| ||| | |||||||||||||||||| || |||||| ||||||| |||| |
|
|
| T |
4927443 |
tggccggggtttgaaccccggaccttacatatattatgctttgtccctaccaactgagctaa |
4927504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Original strand, 10332265 - 10332330
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||| ||| |||| ||||| ||||| ||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
10332265 |
gtggtggcggggttttgaacctccgaccttccatatattatgcattgtccttatcaactgagctaa |
10332330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Original strand, 10735821 - 10735886
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||||||||| ||| | ||||| |||||||||||||| |||||| ||||||| |||| |
|
|
| T |
10735821 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcatcgtccctaccaactgagctaa |
10735886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 65 - 114
Target Start/End: Complemental strand, 12413556 - 12413507
Alignment:
| Q |
65 |
cggggtttgtacctcaaaccttacatatattatgcattatccctatcaac |
114 |
Q |
| |
|
||||||||| |||||| ||||| ||||||||||||||| ||| ||||||| |
|
|
| T |
12413556 |
cggggtttgaacctcagaccttgcatatattatgcattgtccttatcaac |
12413507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 65 - 114
Target Start/End: Complemental strand, 12425616 - 12425567
Alignment:
| Q |
65 |
cggggtttgtacctcaaaccttacatatattatgcattatccctatcaac |
114 |
Q |
| |
|
||||||||| |||||| ||||| ||||||||||||||| ||| ||||||| |
|
|
| T |
12425616 |
cggggtttgaacctcagaccttgcatatattatgcattgtccttatcaac |
12425567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 102
Target Start/End: Original strand, 14735883 - 14735928
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||||||| ||||||||| |
|
|
| T |
14735883 |
gtggtggccggagtttgaacctcgaaccttacatattttatgcatt |
14735928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Original strand, 22523002 - 22523067
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||||||| |||| ||||| |||||| ||||||||||| ||| ||| || ||||||| |||| |
|
|
| T |
22523002 |
gtggtggccgggatttgaacctcgaaccttgcatatattatgtattgtccataccaactgagctaa |
22523067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 24393316 - 24393251
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||| |||||||| | |||||| ||||| ||||||||||||||| ||| || ||||||| |||| |
|
|
| T |
24393316 |
gtggtgtccggggttcgaacctcagaccttgcatatattatgcattgtccttaacaactgagctaa |
24393251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 102
Target Start/End: Original strand, 24581007 - 24581052
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
||||||| ||||||||| ||||| |||||| ||||||||||||||| |
|
|
| T |
24581007 |
gtggtggtcggggtttgaacctcgaaccttgcatatattatgcatt |
24581052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 102
Target Start/End: Complemental strand, 27889360 - 27889315
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
||||| || |||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
27889360 |
gtggtagctggggtttgaacctcaaaccttacatattttatgcatt |
27889315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 29544698 - 29544633
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||||||||| ||| | ||||| ||||||||||||||| |||||| ||| ||| |||| |
|
|
| T |
29544698 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgtccctaccaattgagctaa |
29544633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 98
Target Start/End: Original strand, 32407553 - 32407594
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatg |
98 |
Q |
| |
|
|||||||| | |||||| |||||||||||||||||||||||| |
|
|
| T |
32407553 |
gtggtggctgaggtttgaacctcaaaccttacatatattatg |
32407594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 102
Target Start/End: Original strand, 32957533 - 32957578
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
|||||||||| ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
32957533 |
gtggtggccgaggtttaaaccccaaaccttacatatattatgcatt |
32957578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 34903588 - 34903523
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||| |||||||| | |||||| ||||| ||||||||||||| | ||| || |||||||||||| |
|
|
| T |
34903588 |
gtggtgtccggggttcgaacctcagaccttgcatatattatgcactgtccttaccaactgaactaa |
34903523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 68 - 117
Target Start/End: Complemental strand, 41165495 - 41165446
Alignment:
| Q |
68 |
ggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||| |||||| |||||| |||||||||||||||||| || ||||||| |
|
|
| T |
41165495 |
ggtttgaacctcataccttatatatattatgcattatccataacaactga |
41165446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 2257042 - 2256982
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||||||| | ||| || ||||| ||||||||||||||| ||| || ||||||| |
|
|
| T |
2257042 |
gtggtggccggggttcgaaccccagaccttgcatatattatgcattgtccataccaactga |
2256982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 125
Target Start/End: Original strand, 3197093 - 3197137
Alignment:
| Q |
81 |
aaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||| ||||||||||||||| |||||| ||||||| ||||||| |
|
|
| T |
3197093 |
aaccttgcatatattatgcattgtccctaccaactgagctaaact |
3197137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 4897614 - 4897554
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||| ||||||| ||| ||||||| ||||||||||||||| ||| || ||||||| |
|
|
| T |
4897614 |
gtggtggccagggtttgaaccataaaccttgcatatattatgcattgtccttaccaactga |
4897554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 4945008 - 4944948
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||| ||||||| ||| ||||||| ||||||||||||||| ||| || ||||||| |
|
|
| T |
4945008 |
gtggtggccagggtttgaaccataaaccttgcatatattatgcattgtccttaccaactga |
4944948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 66 - 122
Target Start/End: Complemental strand, 8775332 - 8775276
Alignment:
| Q |
66 |
ggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||| | |||| ||| ||||||||||||||| ||||| |||||||||||| |||| |
|
|
| T |
8775332 |
ggggttcgaaccttaaatcttacatatattatgtattattcctatcaactgacctaa |
8775276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 125
Target Start/End: Complemental strand, 20663119 - 20663079
Alignment:
| Q |
85 |
ttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| ||||||| |
|
|
| T |
20663119 |
ttacatatattatgcattctccctaccaactgagctaaact |
20663079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 22267583 - 22267524
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||| ||||||||| || ||||||||| ||||||||||||||| ||| || ||||||| |
|
|
| T |
22267583 |
gtggtggtcggggtttgaac-tcaaaccttgcatatattatgcattgtccgtaccaactga |
22267524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 66 - 122
Target Start/End: Complemental strand, 22608589 - 22608533
Alignment:
| Q |
66 |
ggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||| |||||| ||||| ||||||||||||||| || ||| ||||||| |||| |
|
|
| T |
22608589 |
ggggtttgaacctcataccttgcatatattatgcattgtctctaccaactgagctaa |
22608533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Complemental strand, 27152424 - 27152364
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||| || ||||| | ||| || ||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
27152424 |
gtggtgtcctgggttcgaaccccagaccttgcatatattatgcattatccctaccaactga |
27152364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 82 - 122
Target Start/End: Complemental strand, 27244703 - 27244663
Alignment:
| Q |
82 |
accttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||| |||| |
|
|
| T |
27244703 |
accttgcatatattatgcattgtccctatcaactgagctaa |
27244663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 27412826 - 27412886
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||| ||||||||| || || ||||||||||||||||||||| || ||| ||||||| |
|
|
| T |
27412826 |
gtggtggtcggggtttgaacaacagaccttacatatattatgcattgtctctaccaactga |
27412886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 125
Target Start/End: Complemental strand, 29734754 - 29734694
Alignment:
| Q |
65 |
cggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||||||| ||| | ||||| ||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
29734754 |
cggggtttgaaccacggaccttgcatatattatgcattgtccatatcaactgagctaaact |
29734694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 82 - 118
Target Start/End: Original strand, 31166122 - 31166158
Alignment:
| Q |
82 |
accttacatatattatgcattatccctatcaactgaa |
118 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
31166122 |
accttacatatattatacattatctctatcaactgaa |
31166158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 31815877 - 31815937
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||| ||||||||| ||| | ||||| ||||||||||||||| |||||| ||||||| |
|
|
| T |
31815877 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccctaccaactga |
31815937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 21)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 65 - 125
Target Start/End: Complemental strand, 28440022 - 28439962
Alignment:
| Q |
65 |
cggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||||||| ||| || |||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
28440022 |
cggggtttgaaccccagaccttacatatattatgcattatctttatcaactgaattaaact |
28439962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 75 - 125
Target Start/End: Complemental strand, 10320549 - 10320499
Alignment:
| Q |
75 |
acctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||| ||||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
10320549 |
acctcataccttacatatattatgcattattcttatcaactgagctaaact |
10320499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 102
Target Start/End: Complemental strand, 3650591 - 3650546
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
||||||||||||||||| ||| | |||||||||||||||||||||| |
|
|
| T |
3650591 |
gtggtggccggggtttgaaccccgaaccttacatatattatgcatt |
3650546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 122
Target Start/End: Original strand, 6038265 - 6038330
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||| ||||| || || ||||||||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
6038265 |
gtggtggccggagtttgaactccagaccttacatatattatgcattgtccatatcaactgagctaa |
6038330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 68 - 125
Target Start/End: Original strand, 32115407 - 32115464
Alignment:
| Q |
68 |
ggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
|||||| ||| | |||||||||||||||||||||| ||| ||| |||||||||||||| |
|
|
| T |
32115407 |
ggtttgaaccccgaaccttacatatattatgcattgtccatattaactgaactaaact |
32115464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 1230651 - 1230711
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||||| | | |||| |||||||||||||||||||||||||||| | |||| ||||||| |
|
|
| T |
1230651 |
gtggtggctgagttttgaacctcaaaccttacatatattatgcattgttcctaccaactga |
1230711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 19260569 - 19260637
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||||||||||||||| ||| | ||||||||||||||||||||| | | |||||||| | ||||||| |
|
|
| T |
19260569 |
gtggtggccggggtttgaaccccggaccttacatatattatgcattgtacatatcaactaagctaaact |
19260637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 58 - 125
Target Start/End: Original strand, 8717466 - 8717533
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||||||| |||||| ||| | |||||| ||||||||||||||| ||| || ||||||| ||||||| |
|
|
| T |
8717466 |
tggtggccgaggtttgaaccccgaaccttgcatatattatgcattgtccataccaactgagctaaact |
8717533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 82 - 117
Target Start/End: Original strand, 19701359 - 19701394
Alignment:
| Q |
82 |
accttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19701359 |
accttacatatattatgcattatccttatcaactga |
19701394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 58 - 117
Target Start/End: Original strand, 26991748 - 26991807
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||| || |||||| ||| |||||||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
26991748 |
tggtggtcgtggtttgaaccacaaaccttgcatatattatgcattgtccatatcaactga |
26991807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 109
Target Start/End: Complemental strand, 18959210 - 18959168
Alignment:
| Q |
67 |
gggtttgtacctcaaaccttacatatattatgcattatcccta |
109 |
Q |
| |
|
||||||| ||||| |||||| |||||||||||||||||||||| |
|
|
| T |
18959210 |
gggtttgaacctcgaaccttgcatatattatgcattatcccta |
18959168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 102
Target Start/End: Original strand, 9192217 - 9192262
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
||||||||||||||||| ||| || || |||||||||||||||||| |
|
|
| T |
9192217 |
gtggtggccggggtttgaaccccagactttacatatattatgcatt |
9192262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 102
Target Start/End: Complemental strand, 9241086 - 9241041
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcatt |
102 |
Q |
| |
|
||||||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
9241086 |
gtggtggccggggtttgaacatcggaccttacatatattatgcatt |
9241041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 98
Target Start/End: Original strand, 27044880 - 27044921
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatg |
98 |
Q |
| |
|
|||||| |||||||||| |||||| ||||||||||||||||| |
|
|
| T |
27044880 |
gtggtgtccggggtttgaacctcagaccttacatatattatg |
27044921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 57 - 118
Target Start/End: Complemental strand, 37141428 - 37141367
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaa |
118 |
Q |
| |
|
||||||||||| ||||| ||| | |||||| ||||||||||||||| ||| || |||||||| |
|
|
| T |
37141428 |
gtggtggccggagtttgaaccccgaaccttgcatatattatgcattgtccataccaactgaa |
37141367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 6235541 - 6235609
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||||||||||||||| | | | |||||||||||||||||||| ||| || ||||||| ||||||| |
|
|
| T |
6235541 |
gtggtggccggggtttgaatcccggaccttacatatattatgcatcgtccataccaactgagctaaact |
6235609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 122
Target Start/End: Complemental strand, 11709056 - 11708992
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||| ||||||||| || || ||||| ||||||||||||||| |||||| ||||||| |||| |
|
|
| T |
11709056 |
tggtggtcggggtttgaacttcggaccttgcatatattatgcattgtccctaccaactgagctaa |
11708992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 13284255 - 13284315
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||| |||||||| ||||||||||||| ||||||||| |||| | | |||||||||| |
|
|
| T |
13284255 |
gtggtggttggggtttgaacctcaaaccttatatatattatacattgttcatatcaactga |
13284315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 13357431 - 13357491
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||||||| |||||| ||||| ||||| ||||||||||||||| ||| || ||||||| |
|
|
| T |
13357431 |
gtggtggccgaggtttgaacctcgtaccttgcatatattatgcattgtccataccaactga |
13357491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 122
Target Start/End: Complemental strand, 35061706 - 35061642
Alignment:
| Q |
58 |
tggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||||||||||||||| |||||||| || |||||||||| ||| || ||||||| |||||||| |
|
|
| T |
35061706 |
tggtggccggggtttgaacctcaaatgttgtatatattatgtattgtctctatcaattgaactaa |
35061642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 122
Target Start/End: Complemental strand, 39821950 - 39821890
Alignment:
| Q |
62 |
ggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
|||| ||||||| ||| || ||||| ||||||||||||||| |||||| ||||||| |||| |
|
|
| T |
39821950 |
ggcctgggtttgaaccccagaccttgcatatattatgcattgtccctaccaactgagctaa |
39821890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0350 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0350
Description:
Target: scaffold0350; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 1319 - 1254
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaa |
122 |
Q |
| |
|
||||||||||| ||||| || || ||||||||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
1319 |
gtggtggccggagtttgaactccagaccttacatatattatgcattgtccatatcaactgagctaa |
1254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 82 - 115
Target Start/End: Complemental strand, 4516 - 4483
Alignment:
| Q |
82 |
accttacatatattatgcattatccctatcaact |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
4516 |
accttacatatattatgcattattcctatcaact |
4483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0161 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0161
Description:
Target: scaffold0161; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 80 - 117
Target Start/End: Complemental strand, 26746 - 26709
Alignment:
| Q |
80 |
aaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
26746 |
aaaccttatatatattatgcattatccctaacaactga |
26709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0334
Description:
Target: scaffold0334; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 125
Target Start/End: Complemental strand, 5253 - 5185
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||||| |||||||| |||||| ||||| ||||||||||||||| ||| || ||| ||| ||||||| |
|
|
| T |
5253 |
gtggtggttggggtttgaacctcagaccttgcatatattatgcattgtccataccaattgagctaaact |
5185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0053 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0053
Description:
Target: scaffold0053; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 118
Target Start/End: Complemental strand, 14258 - 14210
Alignment:
| Q |
70 |
tttgtacctcaaaccttacatatattatgcattatccctatcaactgaa |
118 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||| | |||||||||||| |
|
|
| T |
14258 |
tttgaacctcaaaccttacatatattatgtattgttactatcaactgaa |
14210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 31912 - 31972
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||| || || ||| | ||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
31912 |
gtggtggccggagtgtgaaccccggaccttgcatatattatgcattgtccctatcaactga |
31972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 117
Target Start/End: Original strand, 61560 - 61620
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| |||||||||||||| || ||||||| |
|
|
| T |
61560 |
gtggtggccggggtttgaaccctggaccttacatacattatgcattatccttaccaactga |
61620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 117
Target Start/End: Complemental strand, 99096 - 99048
Alignment:
| Q |
69 |
gtttgtacctcaaaccttacatatattatgcattatccctatcaactga |
117 |
Q |
| |
|
||||| ||| || ||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
99096 |
gtttgaaccccagaccttgcatatattatgcattgtccctatcaactga |
99048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 221003 - 221071
Alignment:
| Q |
57 |
gtggtggccggggtttgtacctcaaaccttacatatattatgcattatccctatcaactgaactaaact |
125 |
Q |
| |
|
||||||| ||||||||| ||| | || || ||||||||||| |||||||||| ||||||| ||||||| |
|
|
| T |
221003 |
gtggtggtcggggtttgaaccctagactttgcatatattatgtattatccctaccaactgagctaaact |
221071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University