View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16217_low_17 (Length: 286)
Name: NF16217_low_17
Description: NF16217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16217_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 5 - 221
Target Start/End: Original strand, 40762821 - 40763037
Alignment:
| Q |
5 |
gtgagatgagtatgttggcctagaaaagtacttatattgtcacaatcccatgtcgtttaagattatgcacactccttcttaagaagatcattgagagtat |
104 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40762821 |
gtgagttgaatatgttggcctagaaaagtacttatattgtcacaatcccatgtcgtttaagattatgcaagctccttcttaagaagatcattgagagtat |
40762920 |
T |
 |
| Q |
105 |
aaatttatataccnnnnnnnttaaacatggataactattttttgtcgacatgcaattgattattttttgcttatacttgtgtttacatagtgtagtccct |
204 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40762921 |
aaatttatataccaaaaaaattaaacatggataactattttttgtcgacatgcaattgattattttttgcttatacttgtgtttacatagtgtagtccct |
40763020 |
T |
 |
| Q |
205 |
atcattttgtgtttcat |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40763021 |
atcattttgtgtttcat |
40763037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 240 - 270
Target Start/End: Original strand, 40763056 - 40763086
Alignment:
| Q |
240 |
tacatgtctttagatgcaatttgacccatct |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40763056 |
tacatgtctttagatgcaatttgacccatct |
40763086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University