View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16217_low_24 (Length: 224)
Name: NF16217_low_24
Description: NF16217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16217_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 37831713 - 37831899
Alignment:
| Q |
18 |
tatgtaagcacacttgaattcacttcaaattttatatatagacgcaattgtgaagttaagatcatttttatagacatagcattgggaagcatgattaaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37831713 |
tatgtaagcacacttgaattcacttcaaattttatatatagacgcaattgtgaagttaagatcatttttatagacatagcattgggaagcatgattaaag |
37831812 |
T |
 |
| Q |
118 |
gggtttgaagtgtgatgattcacttgtttctctatgtccttcaggcaaacctaagttagaaaaaattgaatcaagctaaccatatga |
204 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37831813 |
gggtttgaagtgtgatgattcaattgtttctctatgtccttcaggcaaacctaagttagaaaaaattgaatcaagctaaccatatga |
37831899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University