View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16217_low_8 (Length: 423)
Name: NF16217_low_8
Description: NF16217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16217_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 171 - 407
Target Start/End: Original strand, 43058651 - 43058884
Alignment:
| Q |
171 |
ctcatgcattgatatgatacaaagggagtgaaaataatatttgtatcaagttcgatctctctggtgtcaatttatttctagatattcttatgctcatgac |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43058651 |
ctcatgcattgatatgatacaaagggagtgaaaataatatttgtatcaagttcgatctctccggtgtcaatttatttctagatattcttatgct---gac |
43058747 |
T |
|
| Q |
271 |
ggttccaaaacacaaggagtgttggtacaagaaacaattaccttaacatcaaccataggggaaccagtggccttaacatcaaccacatccaaaaataacg |
370 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43058748 |
ggttccaaaacataaggagtgttggtacaagaaacaattaccttaacatcaaccataggggaaccagtggccttaacatcaaccacatccaagaataacg |
43058847 |
T |
|
| Q |
371 |
tgttttcgaactgtcagcataaaaataggtgtagatg |
407 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43058848 |
tgttttggaactgtcagcataaaaataggtgtagatg |
43058884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 43058499 - 43058541
Alignment:
| Q |
19 |
attctcctattttcctttcccttggtctttatttccccttgat |
61 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43058499 |
attctcccattttcctttcccttggtctttatttccccttgat |
43058541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 267 - 344
Target Start/End: Complemental strand, 15798230 - 15798153
Alignment:
| Q |
267 |
tgacggttccaaaacacaaggagtgttggtacaagaaacaattaccttaacatcaaccataggggaaccagtggcctt |
344 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||| |||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
15798230 |
tgacggttccgaaacacaaggagtgttggcacaagaaacacttactttaacatcaaccacaggggaaccagtggcctt |
15798153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 1e-20; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 273 - 344
Target Start/End: Complemental strand, 24539721 - 24539650
Alignment:
| Q |
273 |
ttccaaaacacaaggagtgttggtacaagaaacaattaccttaacatcaaccataggggaaccagtggcctt |
344 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||| |||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
24539721 |
ttccataacacaaggagtgttggcacaagaaacacttactttaacatcaaccacaggggaaccagtggcctt |
24539650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 268 - 342
Target Start/End: Complemental strand, 24547115 - 24547041
Alignment:
| Q |
268 |
gacggttccaaaacacaaggagtgttggtacaagaaacaattaccttaacatcaaccataggggaaccagtggcc |
342 |
Q |
| |
|
|||| ||||| |||| |||||||||||| ||| |||||| |||||||||||||||||| |||| ||||||||||| |
|
|
| T |
24547115 |
gacgattccataacagaaggagtgttggcacaggaaacacttaccttaacatcaaccacagggaaaccagtggcc |
24547041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University