View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16218_high_13 (Length: 320)
Name: NF16218_high_13
Description: NF16218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16218_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 25 - 314
Target Start/End: Complemental strand, 573537 - 573234
Alignment:
| Q |
25 |
acttctactcgcaatctatgaagcataaacatatacaccgaagcattgatatgtctgacact-------------gaaaattatttaagaaaataagata |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
573537 |
acttctactcgcaatctatgaagcataaacatatacaccgaagcattgatatgtctgacacttgatattgacactgaaaattatttgagaaaataagata |
573438 |
T |
|
| Q |
112 |
attgaatgaaatcatgcatcgtagtacacacacattcgacttgaaatgtttttggttcattgcttggaaagtagaattttgcttcggtgttgctttatga |
211 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
573437 |
attgaatgaaatcatgcatcgcagtacacacacattcgacttgaaatgtttttggttcattgcttggaaagtagaattttgcttcggtgttgttttatga |
573338 |
T |
|
| Q |
212 |
aaatttacaaccatggggttgcttctctc-tttatgttccaagtctttagtttttgtatgtttaaatatgaaatttctttcatgggttgtctcatattct |
310 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
573337 |
aaatttacaaccatggggttgcttctttcttttatgttccaagtctttagtttttgtatgtttaaatatgaaatttctttcatgggttgtctcatctttt |
573238 |
T |
|
| Q |
311 |
tcga |
314 |
Q |
| |
|
|||| |
|
|
| T |
573237 |
tcga |
573234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University