View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16218_high_22 (Length: 239)
Name: NF16218_high_22
Description: NF16218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16218_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 20 - 229
Target Start/End: Complemental strand, 54348238 - 54348029
Alignment:
| Q |
20 |
aaaggcaaagttgggagagaatcccatgaggagtgcgcctgcgaagaagatggagccggcaaggacgatggtgtaacggcgaccaatccagtcagaggtt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54348238 |
aaaggcaaagttgggagagaatcccatgaggagtgcgcctgcgaagaagatggagccagcaaggacgatggtgtaacggcgaccaatccagtcagaggtt |
54348139 |
T |
|
| Q |
120 |
cggccagcgaggcaggaacctattaaggagaaaaggttgatgatgcctactaggatttcaatttggacattagatagtttgaggtctctttttatgtata |
219 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54348138 |
cggccggcgaggcaggaacctattaaggagaaaaggttgatgatgcctactaggatttcaatttggacattagatagtttgaggtctctttttatgtata |
54348039 |
T |
|
| Q |
220 |
tctctgctcc |
229 |
Q |
| |
|
|| ||||||| |
|
|
| T |
54348038 |
tcactgctcc |
54348029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University