View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16218_high_26 (Length: 223)
Name: NF16218_high_26
Description: NF16218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16218_high_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 58 - 206
Target Start/End: Complemental strand, 14701959 - 14701808
Alignment:
| Q |
58 |
taggtattgaaagtaaatatcatgaacttaag---tgcaattagaaaactcatggttaccattaaaatggtattgcagaatccacattgtacatagcata |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14701959 |
taggtattgaaagtaaatatcatgaacttaagaagtgcaattagaaaactcatggttaccattaaaatggtattgcagaatccacattgtacatagcata |
14701860 |
T |
|
| Q |
155 |
tttgttccggaagatcaaaaagatggtttagtgttgacatgatagtgttaat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14701859 |
tttgttccggaagatcaaaaagatggtttagtgttgacatgagtgtgttaat |
14701808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University