View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16218_low_17 (Length: 281)
Name: NF16218_low_17
Description: NF16218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16218_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 18 - 271
Target Start/End: Complemental strand, 41667477 - 41667213
Alignment:
| Q |
18 |
ctaatccatcttcaaatttggataaccatagaaaatattcattataattaaccatctcgatatctccagttgaactagactttatacacatatgaacnnn |
117 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41667477 |
ctaatctatcttcaaatttggataaccatagaaaatattcattataattaaccatctcgatatctccagttgaactagactttatacacatatgaacttt |
41667378 |
T |
 |
| Q |
118 |
nnnnnna--aaataatattgt---------gttttggggtgaaatgtcatttagaaagctacaaacatcataggcgtagtaaattttgattcaaatgaga |
206 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41667377 |
tttttttttaaataatattgttaatattgtgttttggggtgaaatgtcatttagaaagctacaaacatcataggcgtagtaaattttgattcaaatgaga |
41667278 |
T |
 |
| Q |
207 |
attttaattcatctgctcaagtgttctaaacatgttattcatgaaatctttggatcttagttcat |
271 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41667277 |
attttacttcatctgctcaagtgttctaaacatgttattcatgaaatctttggatcttagttcat |
41667213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University