View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16218_low_18 (Length: 274)
Name: NF16218_low_18
Description: NF16218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16218_low_18 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 274
Target Start/End: Original strand, 37142386 - 37142642
Alignment:
| Q |
18 |
attttaatatctactctttgctgtgggttctcaacttgccgccaattgcacatgttcttgtttcttgatctatttcggttctggttattgaacaggaagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37142386 |
attttaatatctactctttgctgtgggttctcaacttgccgcaaattgcacatgttcttgtttcttgatctatttcggttttggttattgaacaggaagg |
37142485 |
T |
 |
| Q |
118 |
aagttcaagtgggaaatgataatattatcctgtgttcttatttctccgaaatctcacccccattttgattcatgtggtcagagcagaccatgaacatgta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37142486 |
aagttcaagtgggaaatgataatattatcctgtgttcttatttctccgaaatctcacccccattttgattcatgtggtcagagcagaccatgaacatgta |
37142585 |
T |
 |
| Q |
218 |
atgttcattcttgtttcttacaaatcaaggaaagtcgttcaagcatctgtttgtagt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37142586 |
atgttcattcttgtttcttacaaatcaaggaaagtcgtgcaagcatctgtttgtagt |
37142642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University