View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16218_low_20 (Length: 255)
Name: NF16218_low_20
Description: NF16218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16218_low_20 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 109 - 255
Target Start/End: Complemental strand, 15378643 - 15378497
Alignment:
| Q |
109 |
gttttcatggaaactcaattttccatgtactccgcgacccaccaattaaattagatataaaattatggttaatttagttgagtatatggttaaacgtgtt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15378643 |
gttttcatggaaactcaattttccatgtactccgcgacccaccaattaaattagatataaaattatggttaatttagttgagtatatggttaaacgtgtt |
15378544 |
T |
 |
| Q |
209 |
taaaattgtaaaattatagttaatcaagaagttgaattacttaaatt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
15378543 |
taaaattgtaaaattatagttaatcaagaagttaaattagttaaatt |
15378497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 10 - 67
Target Start/End: Complemental strand, 15378742 - 15378685
Alignment:
| Q |
10 |
ataattctggatacttatagaactagacgtaaataagtaagtacagtgaatcctgtcg |
67 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
15378742 |
ataattctggatacttatagaacaagacgtaaataagtaagtacggtgaatcctgtcg |
15378685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University