View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16218_low_32 (Length: 207)
Name: NF16218_low_32
Description: NF16218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16218_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 10 - 191
Target Start/End: Complemental strand, 28187827 - 28187646
Alignment:
| Q |
10 |
catcatcatagttattactttcaacaccccctcttccttccttttggtaaaatatccgtgctttcgtaattatggagggaattaccaatggccatgttga |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28187827 |
catcatcatagttattactttcaacaccccctcttccttccttttggtaaaatattcgtgcattcgtaattatggagggaattaccaatggccatgttga |
28187728 |
T |
|
| Q |
110 |
agcaaccttttgtttgagcaaaaatggtggtgatccactcaactggggcgcggcggcggagtcattgagagggagtcatttg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28187727 |
agcaaccttttgtttgagcaaaaatggtggtgatccactcaactggggcgcggcggcggagtcattgacagggagtcatttg |
28187646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University