View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1621_low_11 (Length: 433)
Name: NF1621_low_11
Description: NF1621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1621_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 350
Target Start/End: Original strand, 5256531 - 5256877
Alignment:
| Q |
1 |
atcggaatcgtcttcaagctcaaccctacgcgcgaactcaagtaactctgtcaacgtcttgcggtgcatgtagtacgccgatacggcgacgattgaagct |
100 |
Q |
| |
|
|||||| ||| ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5256531 |
atcggagtcgccttcaggctcaaccgtacgcgcgaactcaagtaactctgtcaacgtcttgcggtgcatgtagtacgccgatacggcgacgattgaagct |
5256630 |
T |
 |
| Q |
101 |
ccgaacagtgccgccatagccaaatgcacggcgtgtgcgtccattttctctctctagaaaagtttctctctctataactgaatttggggagagaagaggg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || ||||||||||||||||||||| | |||||||||||| |
|
|
| T |
5256631 |
ccgaacagtgccgccatagccaaatgcactgcgtgtgcgtccattttctctctctagaaaggtctctctctctataactgaatttagagagagaagaggg |
5256730 |
T |
 |
| Q |
201 |
gatagagaaaaaccctactgnnnnnnntgaagaacgagttgttgactcagtgaaagtattgttgctgagtgagtgagagcgagttggctctgtgttaaat |
300 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5256731 |
gatagagaaaaaccctactg--aaaaatgaagaacgagttgttgactcagtgaaagtattgttgctgggtgagtgagagcgagttggctctgtgttaaat |
5256828 |
T |
 |
| Q |
301 |
ggaagcaatcttgttgcatatgaggtatttatacaaaaacaaccacgttg |
350 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
5256829 |
ggaagcaatcttgttgcatacgaggtatttatacaaaaa-aaccacgttg |
5256877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University