View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1621_low_15 (Length: 397)
Name: NF1621_low_15
Description: NF1621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1621_low_15 |
 |  |
|
| [»] scaffold0024 (3 HSPs) |
 |  |  |
|
| [»] scaffold0742 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 161; Significance: 9e-86; HSPs: 3)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 177 - 381
Target Start/End: Complemental strand, 114139 - 113942
Alignment:
| Q |
177 |
ttcagtgtcttgaaactcagaaactatttgaaatgaatttcctttttactaggtgtgttggtaccnnnnnnntgttgcacaaaggaaaaacagtagttac |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
114139 |
ttcagtgtcttgaaactcagaaactatttgaaatgaatttcctttttactaggtgtgttggtaccaa-------ttgcacaaagtaaaaacagtagttac |
114047 |
T |
 |
| Q |
277 |
aatacaaattttctgaggggaataatttaaccaatacttgctatttatgtttccatcaagctttgaggaattggtttccaaaatacaaccaaatcttgca |
376 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
114046 |
aatgcaaattttctgaggggaataatttaaccaatacttgctatttatgttgccatcaagctttgaggaattggtttccaaaatacaaccaaatcttgca |
113947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 12 - 120
Target Start/End: Complemental strand, 114304 - 114196
Alignment:
| Q |
12 |
atgaacactgaacacgtaattttgtcccggtcttgtatatagaatctctgccaagaactatgcatgtgttcttgtaaggtgttcggtaacatacagaaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
114304 |
atgaacactgaacacgtaattttgtcgcggtcttgtatatagaatctttgccaaaaactatgcatgtgttcttgtaaggtgttctgtaacatactgaaaa |
114205 |
T |
 |
| Q |
112 |
tgcagccat |
120 |
Q |
| |
|
||||||||| |
|
|
| T |
114204 |
tgcagccat |
114196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 22 - 120
Target Start/End: Complemental strand, 120853 - 120755
Alignment:
| Q |
22 |
aacacgtaattttgtcccggtcttgtatatagaatctctgccaagaactatgcatgtgttcttgtaaggtgttcggtaacatacagaaaatgcagccat |
120 |
Q |
| |
|
|||||||||||||||| |||||||| | | |||||||||||||||||||||||||||| ||||||||| ||| |||| |||| |||||||||||||| |
|
|
| T |
120853 |
aacacgtaattttgtcgcggtcttgagcagaaaatctctgccaagaactatgcatgtgtttttgtaaggttttctgtaatatactgaaaatgcagccat |
120755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0742 (Bit Score: 55; Significance: 2e-22; HSPs: 2)
Name: scaffold0742
Description:
Target: scaffold0742; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 251 - 342
Target Start/End: Complemental strand, 181 - 88
Alignment:
| Q |
251 |
ttgcacaaaggaaaaacagtagttacaatacaaattttct--gaggggaataatttaaccaatacttgctatttatgtttccatcaagctttga |
342 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||| ||||| |||||||||||||||||||||||||| ||||||| | |||||||||||||| |
|
|
| T |
181 |
ttgcacaaagtaaaaacagtagttacaatgcaaaatttctatgaggggaataatttaaccaatacttgatatttatatagccatcaagctttga |
88 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0742; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 28 - 104
Target Start/End: Complemental strand, 362 - 286
Alignment:
| Q |
28 |
taattttgtcccggtcttgtatatagaatctctgccaagaactatgcatgtgttcttgtaaggtgttcggtaacata |
104 |
Q |
| |
|
|||||||||| |||||||| | | ||||||||||||||||||||||| |||| || ||| || ||| |||||||| |
|
|
| T |
362 |
taattttgtcgcggtcttgagcagaaaatctctgccaagaactatgcatatgtttttttaaagttttctgtaacata |
286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University