View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1621_low_25 (Length: 276)
Name: NF1621_low_25
Description: NF1621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1621_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 11 - 260
Target Start/End: Complemental strand, 2801689 - 2801440
Alignment:
| Q |
11 |
ttattcttggagctctggattggcgtatgaggtcaattacaccatttcctttcttgaatttcttcatctctttagctcaaattaaggatcgatcacttaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2801689 |
ttattcttggagctctggattggcgtatgaggtcaattacaccgtttcctttcttgaatttcttcatctccttagctcaaattaaggatcgatcacttaa |
2801590 |
T |
|
| Q |
111 |
agatagagctgcagagataatcttcaatgttcataatggtacttcttaatcataactccattttaatcttcagttccaatcctcacaaactgaattacat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2801589 |
agatagagctgcagagataatcttcaatgttcataatggtacttcttaatcataactccattttaatcttcagttccaatcctcacaaactgaattacat |
2801490 |
T |
|
| Q |
211 |
tttatcttatattttatgaatgcagacattaagtttttagagtataaacc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2801489 |
tttatcttatattttatgaatgcagacattaagtttttagagtataaacc |
2801440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University