View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1621_low_30 (Length: 250)
Name: NF1621_low_30
Description: NF1621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1621_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 37889209 - 37889447
Alignment:
| Q |
1 |
cacactattagatgaatacttagacaatttataggtaaatgttctcattgaataaacatgagaaaataatgttgaaaggttagtttagagttgagatttg |
100 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37889209 |
cacactactagatgaaaacttagacaatttataggtaaatgttctcattgaataaacatgagaaaataatgttgaaaggttagtttagagttgagatttg |
37889308 |
T |
 |
| Q |
101 |
aaacttgagaaaatctgagagaatttcttttaaagaagaggcatttagcttcattcaacaaaaattactatggagctctccctacatgctggttttgtca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37889309 |
aaacttgagaaaatctgagagaatttcttttaaagaagagacatttagcttcattcaacaaaaattactatggagctctccct-catgctggttttgtca |
37889407 |
T |
 |
| Q |
201 |
tggtgtcattgacttatcccacatttcttttgcacctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37889408 |
tggtgtcattgacttatcccacatttcttttgcaactatg |
37889447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 87 - 123
Target Start/End: Original strand, 40027185 - 40027221
Alignment:
| Q |
87 |
agagttgagatttgaaacttgagaaaatctgagagaa |
123 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
40027185 |
agagttgagatttgaaacttaagaaaatttgagagaa |
40027221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University