View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1621_low_34 (Length: 233)
Name: NF1621_low_34
Description: NF1621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1621_low_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 12220060 - 12219843
Alignment:
| Q |
1 |
gatagaagaacacctgaatggaagtggtaaattagggaacaagtgaggcttccttaagtgggaaggaaatgttaaaatgtagaataaatctacccaatct |
100 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
12220060 |
gatagaagaaaacctgaatggcagtggtaaattagggaataagtgaggcttccttaagtgggaaggaagtgtgaaaatgtagaacaaatctacccaatct |
12219961 |
T |
|
| Q |
101 |
aatggctcatcttcatacacatcaaccattttaccaaacccttccatatctcctggtttttgccaaagcttacttttctcttccattgaaagattgaaaa |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12219960 |
aatggttcatcttcatacacatcaaccattttaccaaacccttccatatctcctggtttttgccaaagcttactcttctcttccattgaaagattgaaaa |
12219861 |
T |
|
| Q |
201 |
gttctcgagcacctatct |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
12219860 |
gttctcgagcacctatct |
12219843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University