View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1621_low_37 (Length: 229)
Name: NF1621_low_37
Description: NF1621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1621_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 213
Target Start/End: Original strand, 28829596 - 28829789
Alignment:
| Q |
20 |
catcggtcaccggcggtgacggcccaaccgccccgtgttgggccgatcgccgttggtgttaagctagtccagcaagaaggtgtagcagcacttttctccg |
119 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28829596 |
catcggtcaccagcggtgacggcccaaccgccccgtgttgggccgatcgccgttggtgttaagctagtccaacaagaaggtgtagcagcacttttctccg |
28829695 |
T |
 |
| Q |
120 |
gtgtctctgccaccgttctccggcagtgtctctattccaccactcgtatgggactctatgatatgatgaagaaaaaatggtctgatcctatctc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28829696 |
gtgtctctgccaccgttctccggcagtgtctctattccaccactcgtatgggactctatgatatgatgaagaaaaaatggtctgatcctatctc |
28829789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University