View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1621_low_41 (Length: 202)
Name: NF1621_low_41
Description: NF1621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1621_low_41 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 43 - 185
Target Start/End: Original strand, 1504027 - 1504168
Alignment:
| Q |
43 |
tagcatcacggttattaattttaataatcttaaggnnnnnnnnttcaacaactttcgtgctttcacactatgcatctgcagagacacgtcgcgtttgcag |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
1504027 |
tagcatcacggttattaattttaataatcttaaggaaaaaaa-ttcaacaactttcgtgctttcacactatgcatctacagaaacacgtcgcgtttgcag |
1504125 |
T |
 |
| Q |
143 |
aatctatatactctacttttctctgacagcaagtttgatgtgt |
185 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
1504126 |
aatctatatactctacttttctctaacaacaagtttgatgtgt |
1504168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University