View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16222_high_7 (Length: 250)
Name: NF16222_high_7
Description: NF16222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16222_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 243
Target Start/End: Original strand, 3445333 - 3445558
Alignment:
| Q |
17 |
attttaatctttcttgttgtcttctgagtttagatgcatcatcatcacaaatttgcagtaggattcacgtgaatcagataatattattaatgttttagat |
116 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3445333 |
attttaatctttcttgttgtcttttgagtttagatacatcatcatcacaaatttgcagtaggattcacgtgaatcagataatattattaatgttttagat |
3445432 |
T |
 |
| Q |
117 |
atggtttttgttatgatgtatcttatcaacatgatgttgcatgtgtggattatgtcacaaaacatcctttgccatctctttcatgaatctggtttgtgaa |
216 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3445433 |
atggtttttgttatgatgtatgttatcaacatgatgttgcatgtgt-gattatgtcacaaaacatcctttgccatctctttcatgaatctggtttgtgaa |
3445531 |
T |
 |
| Q |
217 |
ggattcttaatgttctttgaatctctg |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3445532 |
ggattcttaatgttctttgaatctctg |
3445558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University