View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16223_high_10 (Length: 297)
Name: NF16223_high_10
Description: NF16223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16223_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 19 - 290
Target Start/End: Complemental strand, 32717565 - 32717294
Alignment:
| Q |
19 |
catccaaaccggcttttgtcatagtgtcagtggctttttctgcaagatctttggaaattttttgcctcttcagattattattggatgtttcaccatgtct |
118 |
Q |
| |
|
||||||||||||||||||||| ||| ||| ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32717565 |
catccaaaccggcttttgtcagagtaccagcggctttttctgaaagatctttggaaatttttcgcctcttcagattattattggatgtttcaccatgtct |
32717466 |
T |
|
| Q |
119 |
gtcacgaattctgctgatagaaacttcagaattattcgagaaaattgattttatcagtgcttcatcttcttctaccagccttatttccttgtctgctgcc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
32717465 |
gtcacgaattctgctgatagaaacttcagaattattcgagaaaattgattttatcagtgcttcatcttcttctaccagccttttctccttgtctgctgcc |
32717366 |
T |
|
| Q |
219 |
ttacgttgcaaagcagcaagcattttatcaacactaacagttgcatgcttagacttcattgacttcatctca |
290 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32717365 |
ttacgttgcaaggcagcaagcattttatcaacactaacagttgcatgcctagacttcattgacttcatctca |
32717294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 205 - 273
Target Start/End: Original strand, 29822569 - 29822637
Alignment:
| Q |
205 |
ccttgtctgctgccttacgttgcaaagcagcaagcattttatcaacactaacagttgcatgcttagact |
273 |
Q |
| |
|
||||||| |||||| |||||||||| || |||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
29822569 |
ccttgtccgctgccgtacgttgcaacgccgcaagcatttcatcaacactaacagttgcatgcctagact |
29822637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 152 - 191
Target Start/End: Original strand, 29821494 - 29821533
Alignment:
| Q |
152 |
attcgagaaaattgattttatcagtgcttcatcttcttct |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29821494 |
attcgagaaaattgattttatcagtgcttcatcttcttct |
29821533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 19 - 87
Target Start/End: Original strand, 29820918 - 29820986
Alignment:
| Q |
19 |
catccaaaccggcttttgtcatagtgtcagtggctttttctgcaagatctttggaaattttttgcctct |
87 |
Q |
| |
|
||||||| ||||||||||||| ||||| || |||||| | |||||||| ||||||||||||||||| |
|
|
| T |
29820918 |
catccaagccggcttttgtcagggtgtcggttgcttttcgaggaagatcttcggaaattttttgcctct |
29820986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 152 - 191
Target Start/End: Complemental strand, 1841151 - 1841112
Alignment:
| Q |
152 |
attcgagaaaattgattttatcagtgcttcatcttcttct |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1841151 |
attcgagaaaattgattttatcagtgcttcatcttcttct |
1841112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 87
Target Start/End: Complemental strand, 1843152 - 1843084
Alignment:
| Q |
19 |
catccaaaccggcttttgtcatagtgtcagtggctttttctgcaagatctttggaaattttttgcctct |
87 |
Q |
| |
|
||||||||| ||||||||||| |||||||| |||||| | |||||||| ||||||||||||||||| |
|
|
| T |
1843152 |
catccaaactggcttttgtcaaggtgtcagttgcttttcgaggaagatcttcggaaattttttgcctct |
1843084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 205 - 273
Target Start/End: Complemental strand, 1839254 - 1839186
Alignment:
| Q |
205 |
ccttgtctgctgccttacgttgcaaagcagcaagcattttatcaacactaacagttgcatgcttagact |
273 |
Q |
| |
|
||||||| ||||| |||||||||| || ||||||||| | ||||||| |||||||||||| |||||| |
|
|
| T |
1839254 |
ccttgtccgctgctgtacgttgcaacgccacaagcatttcagcaacactgacagttgcatgcctagact |
1839186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University